Main Page: Difference between revisions

From CGD Public Wiki
No edit summary
Tag: Manual revert
 
(2 intermediate revisions by the same user not shown)
Line 1,044: Line 1,044:
*[https://pubmed.ncbi.nlm.nih.gov/7784200/ Santos and Tuite, 1995]
*[https://pubmed.ncbi.nlm.nih.gov/7784200/ Santos and Tuite, 1995]
*[https://pubmed.ncbi.nlm.nih.gov/8890179/ Santos et al., 1996]
*[https://pubmed.ncbi.nlm.nih.gov/8890179/ Santos et al., 1996]
*[https://pmc.ncbi.nlm.nih.gov/articles/PMC12471149/ Čermáková and Heidingsfeld, 2025]


===Reassigned CUG as serine===
===Reassigned CUG as serine===
Line 1,297: Line 1,298:
===Crabtree positive (fermentative)===
===Crabtree positive (fermentative)===
*<i>C. glabrata</i>
*<i>C. glabrata</i>
==Virulence Factors==
<B>Notes:</B> Pathogenic yeasts vary in use of secreted and membrane-bound virulence factors involved in invasion, damage and translocation.
<B>References</B>
*[https://pubmed.ncbi.nlm.nih.gov/31544690/ Staniszewska, 2020]
*[https://pubmed.ncbi.nlm.nih.gov/34506621/ Lim et al., 2021]
[[File:Virulence factors.png|frame|center]]
From [https://pubmed.ncbi.nlm.nih.gov/34506621/ Lim et al., 2021]


=Datasets Available in CGD=
=Datasets Available in CGD=

Latest revision as of 17:17, 3 November 2025

Welcome to the CGD Public Wiki

Seminal Candida Papers

C. albicans

Cell Biology

AUTOPHAGY

CELL CYCLE

  • Barton R, Gull K. Variation in cytoplasmic microtubule organization and spindle length between the two forms of the dimorphic fungus Candida albicans. J Cell Sci. 1988 Oct;91 ( Pt 2):211-20.
  • Berman, J. Morphogenesis and cell cycle progression in Candida albicans. 2006 Dec;9(6):595-601. Epub 2006 Oct 20.
  • Chapa y Lazo B, Bates S, Sudbery P. The G1 cyclin Cln3 regulates morphogenesis in Candida albicans. Eukaryot Cell. 2005 Jan;4(1):90-4.
  • Cote P, Hogues H, Whiteway M. Transcriptional analysis of the Candida albicans cell cycle. Mol Biol Cell. 2009 Jul;20(14):3363-73. Epub 2009 May 28.
  • Finley KR, Berman J. Microtubules in Candida albicans hyphae drive nuclear dynamics and connect cell cycle progression to morphogenesis. Eukaryot Cell. 2005 Oct;4(10):1697-711.
  • Singh A, Sharma S, Khuller GK. cAMP regulates vegetative growth and cell cycle in Candida albicans. Mol Cell Biochem. 2007 Oct;304(1-2):331-41. Epub 2007 Jun 8.

CELL WALL

CO2 SENSING

  • Mitchell AP. Fungal CO2 sensing: a breath of fresh air. Curr Biol. 2005 Nov 22;15(22):R934-6.
  • Mock RC, Pollack JH, Hashimoto T. Carbon dioxide induces endotrophic germ tube formation in Candida albicans. Can J Microbiol. 1990 Apr;36(4):249-53.
  • Sims W. Effect of carbon dioxide on the growth and form of Candida albicans. J Med Microbiol. 1986 Nov;22(3):203-8.
  • Webster CE, Odds FC. Growth of pathogenic Candida isolates anaerobically and under elevated concentrations of CO2 in air. J Med Vet Mycol. 1987 Feb;25(1):47-53. Erratum in: J Med Vet Mycol 1988 Feb;26(1):75.

GENETIC INSTABILITY

  • Selmecki A, Bergmann S, Berman J. Comparative genome hybridization reveals widespread aneuploidy in Candida albicans laboratory strains. Mol Microbiol. 2005 Mar;55(5):1553-65.
  • Selmecki AM, Dulmage K, Cowen LE, Anderson JB, Berman J. Acquisition of aneuploidy provides increased fitness during the evolution of antifungal drug resistance. PLoS Genet. 2009 Oct;5(10):e1000705. Epub 2009 Oct 30.
  • Wu W, Pujol C, Lockhart SR, Soll DR. Chromosome loss followed by duplication is the major mechanism of spontaneous mating-type locus homozygosis in Candida albicans. Genetics. 2005 Mar;169(3):1311-27. Epub 2005 Jan 16.
  • Berman J. Ploidy plasticity: a rapid and reversible strategy for adaptation to stress. FEMS Yeast Res. 2016 May;16(3):fow020.

VACUOLAR DYNAMICS AND INHERITANCE

  • Gow NA, Gooday GW. Growth kinetics and morphology of colonies of the filamentous form of Candida albicans. J Gen Microbiol. 1982 Sep;128(9):2187-94.
  • Gow NA, Gooday GW. A model for the germ tube formation and mycelial growth form of Candida albicans. Sabouraudia. 1984;22(2):137-44.
  • Barelle CJ, Bohula EA, Kron SJ, Wessels D, Soll DR, Schafer A, Brown AJ, Gow NA. Asynchronous cell cycle and asymmetric vacuolar inheritance in true hyphae of Candida albicans. Eukaryot Cell. 2003 Jun;2(3):398-410.
  • Veses V, Gow NA. Vacuolar dynamics during the morphogenetic transition in Candida albicans. FEMS Yeast Res. 2008 Dec;8(8):1339-48.
  • Veses V, Richards A, Gow NA. Vacuole inheritance regulates cell size and branching frequency of Candida albicans hyphae. Mol Microbiol. 2009 Jan;71(2):505-19.

DRUG RESISTANCE MECHANISMS

  • Arana DM, Nombela C, Pla J. Fluconazole at subinhibitory concentrations induces the oxidative- and nitrosative-responsive genes TRR1, GRE2 and YHB1, and enhances the resistance of Candida albicans to phagocytes. J Antimicrob Chemother. 2010 Jan;65(1):54-62.
  • Coste A, Selmecki A, Forche A, Diogo D, Bougnoux ME, d'Enfert C, Berman J, Sanglard D. Genotypic evolution of azole resistance mechanisms in sequential Candida albicans isolates. Eukaryot Cell. 2007 Oct;6(10):1889-904.
  • Cowen LE, Steinbach WJ. Stress, drugs, and evolution: the role of cellular signaling in fungal drug resistance. Eukaryot Cell. 2008 May;7(5):747-64.
  • Manoharlal R, Gorantala J, Sharma M, Sanglard D, Prasad R. PAP1 [poly(A) polymerase 1] homozygosity and hyperadenylation are major determinants of increased mRNA stability of CDR1 in azole-resistant clinical isolates of Candida albicans. Microbiology. 2010 Feb;156(Pt 2):313-26.
  • Morschhauser J. Regulation of multidrug resistance in pathogenic fungi. Fungal Genet Biol. 2010 Feb;47(2):94-106.
  • Odds FC. In Candida albicans, resistance to flucytosine and terbinafine is linked to MAT locus homozygosity and multilocus sequence typing clade 1. FEMS Yeast Res. 2009 Oct;9(7):1091-101.
  • Peman J, Canton E, Espinel-Ingroff A. Antifungal drug resistance mechanisms. Expert Rev Anti Infect Ther. 2009 May;7(4):453-60.
  • Rustad TR, Stevens DA, Pfaller MA, White TC. Homozygosity at the Candida albicans MTL locus associated with azole resistance. Microbiology. 2002 Apr;148(Pt 4):1061-72.
  • Sanglard D, Coste A, Ferrari S. Antifungal drug resistance mechanisms in fungal pathogens from the perspective of transcriptional gene regulation. FEMS Yeast Res. 2009 Oct;9(7):1029-50.
  • Selmecki AM, Dulmage K, Cowen LE, Anderson JB, Berman J. Acquisition of aneuploidy provides increased fitness during the evolution of antifungal drug resistance. PLoS Genet. 2009 Oct;5(10):e1000705.
  • Nishimoto AT, Sharma C, Rogers PD. Molecular and genetic basis of azole antifungal resistance in the opportunistic pathogenic fungus Candida albicans. J Antimicrob Chemother. 2020 Feb 1;75(2):257-270.

Transformation/Response

BIOFILMS

CHLAMYDOSPORE DEVELOPMENT

HYPOXIA

  • Ernst JF, Tielker D. Responses to hypoxia in fungal pathogens. Cell Microbiol. 2009 Feb;11(2):183-90.
  • Mulhern SM, Logue ME, Butler G. Candida albicans transcription factor Ace2 regulates metabolism and is required for filamentation in hypoxic conditions. Eukaryot Cell. 2006 Dec;5(12):2001-13.
  • Setiadi ER, Doedt T, Cottier F, Noffz C, Ernst JF. Transcriptional response of Candida albicans to hypoxia: linkage of oxygen sensing and Efg1p-regulatory networks. J Mol Biol. 2006 Aug 18;361(3):399-411.
  • Stichternoth C, Ernst JF. Hypoxic adaptation by Efg1 regulates biofilm formation by Candida albicans. Appl Environ Microbiol. 2009 Jun;75(11):3663-72.

MATING AND THE PARASEXUAL CYCLE

MORPHOGENESIS AND POLARIZED CELL GROWTH

  • Gow NA, Gooday GW. Growth kinetics and morphology of colonies of the filamentous form of Candida albicans. J Gen Microbiol. 1982 Sep;128(9):2187-94.
  • Gow NA, Gooday GW. Vacuolation, branch production and linear growth of germ tubes in Candida albicans. J Gen Microbiol. 1982 Sep;128(9):2195-8.
  • [https://pubmed.ncbi.nlm.nih.gov/3319423/ Gow NA, Gooday GW. Cytological aspects of dimorphism in Candida albicans. Crit Rev Microbiol. 1987;15(1):73-8.
  • Gow NA. Germ tube growth of Candida albicans. Curr Top Med Mycol. 1997 Dec;8(1-2):43-55.
  • Berman, J. Morphogenesis and cell cycle progression in Candida albicans. 2006 Dec;9(6):595-601.
  • Sinha I, Wang YM, Philp R, Li CR, Yap WH, Wang Y. Cyclin-dependent kinases control septin phosphorylation in Candida albicans hyphal development. Dev Cell. 2007 Sep;13(3):421-32.
  • Veses V, Gow NA. Vacuolar dynamics during the morphogenetic transition in Candida albicans. FEMS Yeast Res. 2008 Dec;8(8):1339-48.
  • Veses V, Richards A, Gow NA. Vacuole inheritance regulates cell size and branching frequency of Candida albicans hyphae. Mol Microbiol. 2009 Jan;71(2):505-19.
  • Wang Y. CDKs and the yeast-hyphal decision. Curr Opin Microbiol. 2009 Dec;12(6):644-9.
  • Whiteway M, Bachewich C. Morphogenesis in Candida albicans. Annu Rev Microbiol. 2007;61:529-53.
  • Du H, Ennis CL, Hernday AD, Nobile CJ, Huang G. N-Acetylglucosamine (GlcNAc) Sensing, Utilization, and Functions in Candida albicans. J Fungi (Basel). 2020 Aug 7;6(3):129.

WHITE-OPAQUE SWITCHING

PH RESPONSE

  • Bensen ES, Martin SJ, Li M, Berman J, Davis DA. Transcriptional profiling in Candida albicans reveals new adaptive responses to extracellular pH and functions for Rim101p. Mol Microbiol. 2004 Dec;54(5):1335-51.
  • Davis DA. How human pathogenic fungi sense and adapt to pH: the link to virulence. Curr Opin Microbiol. 2009 Aug;12(4):365-70.
  • Davis D. Adaptation to environmental pH in Candida albicans and its relation to pathogenesis. Curr Genet. 2003 Oct;44(1):1-7. Erratum in: Curr Genet. 2003 Oct;44(1):58.
  • Davis D, Wilson RB, Mitchell AP. RIM101-dependent and-independent pathways govern pH responses in Candida albicans. Mol Cell Biol. 2000 Feb;20(3):971-8.
  • Kullas AL, Martin SJ, Davis D. Adaptation to environmental pH: integrating the Rim101 and calcineurin signal transduction pathways. Mol Microbiol. 2007 Nov;66(4):858-71.
  • Ramon AM, Fonzi WA. Diverged binding specificity of Rim101p, the Candida albicans ortholog of PacC. Eukaryot Cell. 2003 Aug;2(4):718-28.
  • Ramon AM, Porta A, Fonzi WA. Effect of environmental pH on morphological development of Candida albicans is mediated via the PacC-related transcription factor encoded by PRR2. J Bacteriol. 1999 Dec;181(24):7524-30.

QUORUM SENSING

STRESS RESPONSES

  • Alonso-Monge R, Roman E, Arana DM, Pla J, Nombela C. Fungi sensing environmental stress. Clin Microbiol Infect. 2009 Jan;15 Suppl 1:17-9.
  • Arana DM, Nombela C, Pla J. Fluconazole at subinhibitory concentrations induces the oxidative- and nitrosative-responsive genes TRR1, GRE2 and YHB1, and enhances the resistance of Candida albicans to phagocytes. J Antimicrob Chemother. 2010 Jan;65(1):54-62.
  • Deveau A, Piispanen AE, Jackson AA, Hogan DA. Farnesol induces hydrogen peroxide resistance in Candida albicans yeast by inhibiting the Ras-cyclic AMP signaling pathway. Eukaryot Cell. 2010 Apr;9(4):569-77.
  • Reedy JL, Filler SG, Heitman J. Elucidating the Candida albicans calcineurin signaling cascade controlling stress response and virulence. Fungal Genet Biol. 2010 Feb;47(2):107-16.
  • Rodaki A, Bohovych IM, Enjalbert B, Young T, Odds FC, Gow NA, Brown AJ. Glucose promotes stress resistance in the fungal pathogen Candida albicans. Mol Biol Cell. 2009 Nov;20(22):4845-55.
  • Berman J. Ploidy plasticity: a rapid and reversible strategy for adaptation to stress. FEMS Yeast Res. 2016 May;16(3):fow020.

THIGMOTROPISM, GALVANOTROPISM AND CONTACT-SENSING

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE AND VIRULENCE FACTORS

C. glabrata

Cell Biology

CELL WALL

GENE SILENCING

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

MATING AND MATING LOCI

PHENOTYPIC SWITCHING

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE FACTORS

C. parapsilosis

Cell Biology

CELL WALL

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

ADHESION

MATING LOCI

PHENOTYPIC SWITCHING

STRESS RESPONSE

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE FACTORS

C. auris

Cell Biology

CELL WALL

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

ADHESION

MATING LOCI

PHENOTYPIC SWITCHING


STRESS RESPONSE

Virulence

HOST-PATHOGEN INTERACTIONS


VIRULENCE FACTORS

C. dubliniensis

Cell Biology

CELL WALL

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

ADHESION

MATING LOCI

CHLAMYDOSPORE DEVELOPMENT

FILAMENTATION

STRESS RESPONSE

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE FACTORS

C. tropicalis

Cell Biology

CELL WALL

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

ADHESION

  • Bendel CM, Hostetter MK. Distinct mechanisms of epithelial adhesion for Candida albicans and Candida tropicalis. Identification of the participating ligands and development of inhibitory peptides. J Clin Invest. 1993 Oct;92(4):1840-9.
  • de Souza CM, Dos Santos MM, Furlaneto-Maia L, Furlaneto MC. Adhesion and biofilm formation by the opportunistic pathogen Candida tropicalis: what do we know? Can J Microbiol. 2023 Jun 1;69(6):207-218. (Review)

MATING AND MATING LOCI

FILAMENTATION

STRESS RESPONSE

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE FACTORS

Current Taxonomy

The genus Candida was originally formed as a heterogeneous grouping of opportunistic pathogenic budding yeasts that lacked sexual reproduction (Groenewald et al., 2023). Further genomic study has revealed evolutionary distances between these species that argues for taxonomic revision within the budding yeast subphylum Saccharomycotina (Shen et al., 2020, Liu et al., 2024, Kidd et al., 2023). Interestingly, it appears pathogenicity within humans has evolved multiple times in this subphylum (Rokas, 2022)

NCBI has recently announced adoption of new taxonomy that affects the Candida community.

The specific name changes are as follows:

  • Clavispora lusitaniae (syn. Candida lusitaniae )
  • Pichia kudriavzevii (syn. Candida krusei )
  • Meyerozyma guilliermondii (syn. Candida guilliermondii )
  • Nakaseomyces glabratus (syn. Candida glabrata )
  • Candidozyma auris (syn. Candida auris )

Strain Information

Candida albicans Strains

SC5314

Genotype: wild type

Notes: Wild-type strain used in the systematic sequencing project, the reference sequence stored in CGD. The original strain background from which most of the common laboratory strains are derived. This strain is virulent in a mouse model of systemic infection and is frequently used as a wild-type control. In their 2004 Genome Biology paper on C. albicans genome sequence, Frank Odds, Al Brown and Neil Gow explain the origins of SC5314: "Strain SC5314 was used in the 1980s by scientists at the E.R. Squibb company (now Bristol-Myers Squibb, see Note1) for their pioneering studies of C. albicans molecular biology. It was engineered by Fonzi and Irwin to provide the uridine autotrophic mutant that has been essential to most subsequent molecular genetic research into C. albicans. The strain is usually described merely as a 'clinical isolate', but it is worth setting on record that SC5314 was originally isolated from a patient with generalized Candida infection by Margarita Silva-Hutner (see Note 2) at the Department of Dermatology, Columbia College of Physicians and Surgeons (New York, USA). The original isolate number was 1775 and the strain is identical with strain NYOH#4657 in the New York State Department of Health collection. (This information was provided by Joan Fung-Tome at Bristol-Myers Squibb as a personal communication.) SC5314 belongs to the predominant clade of closely related C. albicans strains that represents almost 40% of all isolates worldwide, as determined by DNA fingerprinting and multi-locus sequence typing (A. Tavanti, A.D. Davidson, N.A.R.G., M.C.J. Maiden and F.C.O., unpublished observations)."

Note 1: The earliest publications that used SC5314 came in 1968 from Squibb Institute for Medical Research.

Note 2: The documentation of the work done by Margarita Silva-Hutner and her lab is preserved at Columbia University Archival Collections.

References: Odds et al., 2004. Genome Biol. 2004; 5(7): 230; Fonzi and Irwin, 1993. 1993 Jul;134(3):717-28; Aszalos et al., 1968. J Antibiot (Tokyo). 1968 Oct;21(10):611-5; Maestrone and Semar, 1968. Naturwissenschaften. 1968 Feb;55(2):87-8; Meyers et al., 1968. Appl Microbiol. 1968 Apr;16(4):603-8.

BWP17

Genotype: ura3::imm434/ura3::imm434 iro1/iro1::imm434 his1::hisG/his1::hisG arg4/arg4

Notes: Isogenic to the SC5314 strain. Uridine, histidine and arginine auxotroph derived from the RM1000 strain by deletion of the ARG4 gene. This strain has a heterozygous deletion on chromosome 5 that was inherited from the RM1000 parental strain.

References: Wilson et al., 1999. J Bacteriol. 1999 Mar;181(6):1868-74.

CAF2-1

Genotype: URA3/ura3::imm434 IRO1/iro1::imm434

Notes: URA3 heterozygous strain derived from the SC5314 strain. The 3-prime end of one copy of the IRO1 gene that resides adjacent to URA3 was inadvertently deleted during the construction of this strain. This strain is virulent in a mouse model of systemic infection and is frequently used as a wild-type control.

References: Fonzi and Irwin, 1993. Genetics 1993 Jul;134(3):717-28.

CAI4

Genotype: ura3::imm434/ura3::imm434 iro1/iro1::imm434

Notes: Isogenic to the SC5314 strain. Uridine auxotroph constructed by deletion of the second copy of URA3. The second copy of IRO1 was inadvertently deleted upon strain construction. As a result, the strain and its descendants have no functional copy of IRO1. This strain is avirulent in a mouse model of systemic infection unless complemented with URA3.

References: Fonzi and Irwin, 1993. Genetics 1993 Jul;134(3):717-28; Garcia et al., 2001. Yeast. 2001 Mar 15;18(4):301-11.

CAI8

Genotype: ura3::imm434/ura3::imm434 iro1/iro1::imm434 ade2::hisG/ade2::hisG

Notes: Isogenic to the SC5314 strain. Derived from the CAF2-1 strain by deletion of URA3 and both copies of ADE2 using the URA-blaster method.

References: Fonzi and Irwin, 1993. Genetics 1993 Jul;134(3):717-28.

P37005

Genotype: MTLa/MTLa

Notes: Wild-type clinical isolate. Naturally homozygous for the MTLa mating type locus.

References: Lockhart et al., 2002. Genetics. 2002 Oct;162(2):737-45.

Red3/6

Genotype: ade2/ade2

Notes: Isogenic to the WO-1 strain. Adenine auxotroph derived from the WO-1 strain by chemical mutagenesis using MNNG.

References: Srikantha et al., 1995. Mol Cell Biol. 1995 Mar;15(3):1797-805.

RM1000

Genotype: ura3::imm434/ura3::imm434 iro1/iro1::imm434 his1::hisG/his1::hisG

Notes: Isogenic to the SC5314 strain. Derived from the CAI4 strain by deletion of the HIS1 gene using the URA-blaster method (see Fonzi and Irwin, 1993 for details of this method). The standard RM1000 strain was found to have a heterozygous deletion on chromosome 5. RM1000#2 is an isolate that has been shown to have wild-type copies of chromosome 5.

References: Negredo et al., 1997. Microbiology. 1997 Feb;143 ( Pt 2):297-302.

SN87

Genotype: ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2

Notes: Isogenic to the SC5314 strain. Histidine and leucine auxotroph derived from the RM1000#2 strain by deletion of the LEU2 gene. This strain is virulent in a mouse model of systemic infection.

References: Noble and Johnson, 2005. Eukaryot Cell. 2005 Feb;4(2):298-309.

SN95

Genotype: ura3::imm434::URA3/ura3iro1IRO1/iro1his1his1arg4/arg4

Notes: Isogenic to the SC5314 strain. Histidine and arginine auxotroph derived from the RM1000#2 strain by deletion of the ARG4 gene. This strain is virulent in a mouse model of systemic infection.

References: Noble and Johnson, 2005. Eukaryot Cell. 2005 Feb;4(2):298-309.

SN152

Genotype: ura3/::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4

Notes: Isogenic to the SC5314 strain. Histidine, leucine and arginine auxotroph derived from the RM1000#2 strain by deletion of the LEU2 and ARG4 genes. This strain is virulent in a mouse model of systemic infection.

References: Noble and Johnson, 2005. Eukaryot Cell. 2005 Feb;4(2):298-309.

SN250

Genotype: his1Δ/his1Δ, leu2Δ::C.dubliniensis HIS1 /leu2Δ::C.maltosa LEU2, arg4Δ /arg4Δ, URA3/ura3Δ::imm434, IRO1/iro1Δ::imm434

Notes: Isogenic to the SC5314 strain. Derived from SN87 by integration of C. dubliniensis HIS1 and C. maltosa LEU2 at the disrupted leu2 loci and then deleted for arg4. Derived from SN87 and QMY23.

References: Noble et al., 2010. Nat Genet. 2010 Jul;42(7):590-8;

Mitrovich et al., 2007. Genome Res. 2007 Apr;17(4):492-502.

WO-1

Genotype: MTLalpha

Notes: Wild-type clinical isolate that switches between white and opaque phenotypes at high frequency. The MTLa locus is absent in this strain (for more information see Lockhart et al., 2002). This strain has been sequenced by the Broad Institute (http://www.broadinstitute.org/annotation/genome/candida_group/GenomeDescriptions.html)

References: Slutsky et al., 1987. J Bacteriol. 1987 Jan;169(1):189-97; Lockhart et al., 2002. Genetics. 2002 Oct;162(2):737-45.

WUM5A

Genotype: MTLalpha/MTLalpha ura3-1Δ::FRT/ura3-2Δ::FRT

Notes: Isogenic to the WO-1 strain. Uridine auxotroph constructed by deletion of both copies of URA3.

References: Strauss et al. 2001. J Bacteriol. 2001 Jun;183(12):3761-9.

Candida glabrata (Nakaseomyces glabratus) Strains

B

Genotype: Wild type

Notes: Clinical isolate from a case of vaginitis that did not respond to fluconazole or boric acid treatment; it is virulent in a murine model of vaginitis. This strain was called LF 547.92 in the original publication.

References: Fidel et al., 1996. J Infect Dis. 1996 Feb;173(2):425-31.

BG2

Genotype: Wild type

Notes: Clinical isolate from a case of vaginitis that did not respond to fluconazole or boric acid treatment; it is virulent in a murine model of vaginitis

References: Cormack and Falkow, 1999. Genetics. 1999 Mar;151(3):979-87.

BG14

Genotype: ura3-delta(-285 +932)::Tn903NeoR

Notes: A ura3 derivative of the wild-type B2 clinical isolate.

References: Cormack and Falkow, 1999. Genetics. 1999 Mar;151(3):979-87.

BG462

Genotype: URA3

Notes: A derivative of the B2 clinical isolate with the URA3 gene restored

References: De Las Peñas, et al., 2003. Genes Dev. 2003 Sep 15;17(18):2245-58.

CBS138 (ATCC 2001)

Genotype: Wild type

Notes: Type strain for the Genolevures C. glabrata sequencing project. This strain has also been called NRRL-Y-65 and IFO 0622.

References: Dujon et al., 2004. Nature. 2004 Jul 1;430(6995):35-44; Koszul, et al., 2003. FEBS Lett. 2003 Jan 16;534(1-3):39-48.

2001T

Genotype: trp1

Notes: A trp1 auxotrophic strain derived from the CBS138 (ATCC 2001) wild-type strain.

References: Kitada et al., 1995. Gene. 1995 Nov 20;165(2):203-6.

2001HT

Genotype: his3 trp1::ScURA3

Notes: A his3 trp1 auxotrophic strain derived from 200T, a derivative of the CBS138 (ATCC 2001) wild-type strain.

References: Kitada et al., 1995. Gene. 1995 Nov 20;165(2):203-6.

NCCLS84 (ATCC 90030)

Genotype: Wild type

Notes: Wild-type strain

References: Espinel-Ingroff et al., 1992. J Clin Microbiol. 1992 Dec;30(12):3138-45

84u

Genotype: ura3

Notes: A ura3 derivative of the wild-type NCCLS84 (ATCC90030) strain.

References: Tsai et al., 2006. Antimicrob Agents Chemother. 2006 Apr;50(4):1384-92.

Candida parapsilosis Strains

ATCC 22019

Genotype: heterozygous MET/met

Notes: Application of parasexual genetic methods was used to determine that C. parapsilosis strain ATCC 22019 is is heterozygous MET/met

References: Whelan and Kwon-Chung, 1988. J Med Vet Mycol 1988 Jun;26(3):163-71.

CDC317

Genotype: Wild type

Notes: Reference strain used for the C. parapsilosis sequencing project. This isolate came from the hands of a hospital worker, who was the source for an outbreak of infection in a Mississippi community hospital in 2001.

References: Kuhn et al., 2004. Emerg Infect Dis. 2004 Jun;10(6):1074-81; Clark et al., 2004. J Clin Microbiol. 2004 Oct;42(10):4468-72.

CLIB214 (CBS 604; ATCC 22019; NRRL Y-12969)

Genotype: Wild type

Notes: Type strain, originally isolated from a patient with diarrhea in Puerto Rico by Ashford (1928). This strain is dependent on oxidative metabolism for growth since it lacks a fermentative pathway.

References: Ashford, 1928. Am J Trop Med 8:507�538. In: Kurtzman CP, Fell JW, Boekhout T (eds), 2011. The yeasts: a taxonomic study. p. 987-1278, 5th ed. Elsevier, London, United Kingdom; Logue et al., 2005. Eukaryot Cell 4(6):1009-17.

CPL2

Genotype: leu2Δ::FRT/leu2Δ::FRT, his1Δ::FRT/his1Δ::FRT, frt::CdHIS1

Notes: Leucine auxotroph laboratory strain

References: Németh et al., 2021. Virulence. 2021 Dec;12(1):937-950.

GA1

Genotype: Wild type

Notes: Wild-type clinical isolate. The SAT1 flipper method and the Candida albicans IMH3 gene have been used as dominant-selectable markers to construct gene knockouts in this strain.

References: Gácser et al., 2005. FEMS Microbiol Lett. 2005 Apr 1;245(1):117-21; Gácser et al., 2007. J Clin Invest. 2007 Oct;117(10):3049-58.

SR23 (CBS7157)

Genotype: ade- lys-

Notes: An adenine and lysine auxotroph isolated from a contaminated culture of Saccharomyces cerevisiae as a yeast with peculiar physiological features and carrying a linear mitochondrial DNA

References: Kovac et al., 1984. Mol Gen Genet 197:420-424; Nosek et al., 2004. Mol Genet Genomics 272(2):173-80; Mutalová et al., 2024. Microbiol Resour Announc. 2024 Jul 31;13(9):e00347-24.

Candida auris (Candidozyma auris) Strains

AR0382 (B11109)

Genotype: Wild type

Notes: Aggregative strain with high biofilm formation.

References: Vila et al., 2020. mSphere. 2020 Aug 5;5(4):e00760-20; Wang et al., 2024. Nat Commun. 2024 Oct 25;15(1):9212.

AR0387 (B8441)

Genotype: Wild type

Notes: Reference strain; non-aggregative strain with low biofilm formation.

References: Vila et al., 2020. mSphere. 2020 Aug 5;5(4):e00760-20; Wang et al., 2024. Nat Commun. 2024 Oct 25;15(1):9212.

AR0389

Genotype: erg11-Y132F

Notes: Has high drug resistance due to an ERG11 mutation (Y132F) and overexpression of the drug efflux transporter gene CDR1.

References: Shinohara et al., 2024. JAC Antimicrob Resist. 2024 Feb 21;6(1):dlad155.

AR0390 (B11205)

Genotype: erg11-K143R

Notes: Clinical isolate with high fluconazole resistance.

References: Rybak et al., 2021. Microbiol Spectr. 2021 Dec 8;9(3):e01585-21.

B11220

Genotype: Wild type

Notes: Clade II clinical isolate with susceptibility to all antifungal drugs.

References: Yang et al., 2024. Infect Immun. 2024 Jun 11;92(6):e0010324.

B11221

Genotype: Wild type

Notes: Clade III clinical isolate with resistance to caspofungin. Contains an L-rhamnose utilization cluster that appears to allow more ready use of alternate sugars, better drug tolerance, and better survival from host immune cell attack, possibly due to reduced β-(1,3)-glucans at the cell surface.

References: Yang et al., 2024. Infect Immun. 2024 Jun 11;92(6):e0010324.

Candida tropicalis Strains

ATCC 20336 (pK233)

Genotype: Wild type

Notes: This strain excretes alpha,omega-dicarboxylic acids as a by-product when cultured on n-alkanes or fatty acids as the carbon source.

References: Craft et al., 2003. Appl Environ Microbiol 69(10):5983-91.

ATCC 20913

Genotype: ura3/ura3

Notes: A uracil auxotroph derived from C. tropicalis ATCC 20336 by random mutagenesis.

References: Haas et al., 1990. J Bacteriol 172(8):4571-7.

ATCC 750

Genotype: Wild type

Notes: A wild-type fluconazole susceptible strain.

References: Barchiesi et al., 2000. Antimicrob Agents Chemother 44(6):1578-84.

NCYC2512

Genotype: Wild type

Notes: A wild-type saline soil isolate from Pakistan that is capable of producing large amounts of alpha,omega-dodecanedioic acid.

References: Rodriguez et al., 1996. Yeast 12(13):1321-9.

1230

Genotype: Wild type

Notes: A wild-type dicarboxylic acid-producing industrial strain.

References: He and Chen, 2005. Yeast 22(6):481-91.

Candida dubliniensis Strains

CD36

Genotype: Wild type

Notes: Type strain, oral isolate from an HIV+ patient in Ireland; also catalogued as NCPF 3949 and CBS-7987.

References: Sullivan et al., 1995. Microbiology (Reading) 1995 Jul:141 ( Pt 7):1507-21.

Protocols and Methods

Candida Identification

Universal primers

  • used to amplify ITS genes for subsequent sequencing to identify species
    • Fungi_ITS_Seq_F: GTGAATCATCGAATCTTTGAA
    • Fungi_ITS_Seq_R: TCCTCCGCTTATTGATATGC
    • These are primers ITS86F and ITS4 from the reference Park et al.
    • The primers themselves are from older literature, but this combination seems to work best for yeast species

Candida albicans Protocols and Methods

Candida glabrata (Nakaseomyces glabratus) Protocols and Methods

  • Genetic manipulation of C. glabrata

Candida parapsilosis Protocols and Methods

Candida auris (Candidozyma auris) Protocols and Methods

Candida dubliensis Protocols and Methods

Candida tropicalis Protocols and Methods

Species Comparisons by Topic

Ploidy

Notes: Candida albicans and its close relatives are all on a single phylogenetic branch characterized by diploidy, while the two typical haploid species (C. glabrata and C. auris) are on distinct, distantly related branches for which haploidy is the standard form. Note that the two haploid pathogens are more prone to pleiotropic resistance because only a single mutation is needed in the haploid genome to generate stable change.

References:

Typical diploids

  • C. albicans
  • C. dubliniensis
  • C. parapsilosis
  • C. tropicalis

Typical haploids

  • C. glabrata
  • C. auris

From Munoz et al., 2018


CUG codon usage

Notes: Yeasts of the Candida clade (as opposed to C. glabrata, also known as Nakaseomyces glabratus, which is on the Saccharomyces clade) have undergone an evolutionary reassignment of the CUG codon from leucine to serine. This is due to a novel serine-tRNA (ser-tRNACAG) that contains a guanosine at position 33, a position that is occupied by a pyrimidine (uridine) in nearly all other tRNAs.

References:

Reassigned CUG as serine

  • C. albicans
  • C. dubliniensis
  • C. parapsilosis
  • C. tropicalis
  • C. auris

Standard CUG as leucine

  • C. glabrata


From Butler et al., 2009

Mitochondrial genome

Notes: Candida parapsilosis is unusual in having a mitochondrial genome that is linear and capped by telomeric ends. The close relatives of this species, C. orthopsilosis and C. metapsilosis and Candida subhashii, have a mix of circular and linear mitochondrial genomes. The other Candida spp. are exclusively circular.

References:

Exclusively linear

  • C. parapsilosis

Mix of linear and circular

  • C. orthopsilosis
  • C. metapsilosis
  • C. subhashii

Exclusively circular

  • C. albicans
  • C. dubliniensis
  • C. tropicalis
  • C. auris
  • C. glabrata

From Kosa et al., 2006

Filamentous growth

Notes: Candida spp. vary in filamentous growth as a means of infection/invasion. C. albicans and its close relative C. dubliniensis use true hyphae to penetrate tissues, while C. parapsilosis and C. tropicalis can penetrate tissues by means of pseudohyphae (lacking septa). In contrast, C. glabrata almost never forms filaments and infects in the yeast form. C. auris is an outlier in that it infects both by pseudohyphae and in the yeast form.

Note that the classifications below represent the typical forms for each species, but exceptions are not unusual.

References:

Invasive/infectious by true hyphae

  • C. albicans
  • C. dubliniensis

Invasive/infectious pseudohyphal growth (lacking septa)

  • C. parapsilosis
  • C. tropicalis
  • C. auris

Invasive/infectious as yeast form

  • C. glabrata
  • C. auris

Biofilms

Notes: Candida species all form biofilms but not in the same manner. Biofilms all begin as adherence to a surface and then excretion of an extracellular matrix composed mainly of proteins, carbohydrates, and lipids. All species employ extracellular vesicles to facilitate excretion. They differ in the types of cells that inhabit the biofilm environment.

References:

Biofilms comprising primarily filamentous cells

  • C. albicans
  • C. dubliniensis (but mature biofilms are composed predominately of pseudohyphae rather than true hyphae (26432632)

Biofilms comprising mixed yeast and pseudohyphae

  • C. tropicalis
  • C. parapsilosis
  • C. auris

Biofilms comprising primarily yeast cells

  • C. glabrata

Pathogenicity

Notes: Candida species show heterogeneity in pathogenicity, where each species has a unique profile. See descriptions below.

References:

C. albicans

  • Exclusively commensal, C. albicans is fully adapted to the mammalian host, characterized by high thermotolerance and an advance ability to respond to changes in the body
  • While non-albicans species are increasingly the cause of disease, C. albicans remains the most prevalent pathogen causing candidiasis
  • Virulence properties are extensive, including the ability to (1) switch from the yeast form to the hyphal form; (2) secrete adhesins, biofilm matrix components, proteases, and hydrolytic enzymes; (4) undergo phenotypic change to allow sexual reproduction; (5) adapt metabolic processes to available nutrients; and (6) evade immune responses by various means

C. parapsilosis

  • C. parapsilosis is the second or third most commonly isolated pathogenic species in several parts of the world
  • Can live either commensally or freely in a wide range of ecological niches
  • Has an enhanced ability to adhere to inert surfaces and is thus a particular problem in neonates, transplant recipients, and patients receiving parenteral nutrition

C. tropicalis

  • Can live either commensally or freely in diverse environments
  • More commonly associated with neutropenia and malignancy

C. glabrata

  • Exclusively commensal, with an enormous ability to adapt to various stresses within the human body, including low availability of carbon, iron, and nitrogen, low pH, and both high and low oxygen levels
  • Upon pathogenic invasion, can reach fatality levels of 50%
  • More often associated with adults than children and is thus more prevalent in wealthier nations, where demographics skew to higher average age.

C. dubliniensis

  • As a close relative of C. albicans, C. dubliniensis is a successful colonizer of the human host. However, it primarily lives as a benign commensal and only rarely causes invasive infection
  • When C. dubliniensis does cause infection, it most commonly causes oral candidiasis (see Moyes et al. and Chen et al.)

C. auris

  • C. auris was only recognized as a human pathogen in 2009 and may have only recently evolved the ability to colonize the human host
  • Can live either commensally or freely in a wide range of ecological niches
  • It has been hypothesized that C. auris made the shift to commensalism due to climate change, where increasing terrestrial temperatures made it more possible to bridge the transition into the high-temperature environment inside a mammal
  • As C. auris preferentially colonizes the cooler skin rather than the hotter gut microbiome, new commensalism may be consistent with a recent acquisition of thermotolerance
  • The inclination to colonize skin has made C. auris particularly problematic in hospital settings, where widespread outbreaks have become common

Mating/Reproduction

Notes: Candida species show heterogeneity in mating/reproduction, as described below. References are by species.

C. albicans

  • Undergoes both heterothallic and homothallic reproduction
  • Heterothallic reproduction between two haploids of opposite mating type occurs at low frequency and requires a phenotypic switch from the white to the opaque state, where the opaque state is mating competent
  • Does not appear to undergo mating type switching within a strain
  • Once mating occurs, the fungus does not undergo a meiotic program but instead reduces chromosome number by chromosome loss
  • Parasexual (i.e., homothallic) reproduction via the mating of two diploids is likewise followed by chromosome loss leading to aneuploidy
  • Has a remarkable tolerance for aneuploidy

From Alby and Bennett, 2010

Slutsky et al., 1987 Alby and Bennett, 2010 (review) Butler et al., 2004 Noble and Johnson, 2007 (review)

C. dubliniensis

  • Undergoes mating similarly to C. albicans and is likely to complete the mating cycle by parasexual loss of chromosomes rather than meiosis
  • Requires phenotypic switching from white to opaque before mating
  • Has a higher percentage (~30%) of natural strains that are MTL homozygous (a/a or alpha/alpha) than does C. albicans (~8%)


Pujol et al., 2004 Pujol et al., 2015 Alby and Bennett, 2010 (review) Butler et al., 2004

C. tropicalis

  • Undergoes both homothallic and heterothallic mating, followed by chromosome loss rather than meiosis
  • Tetraploid progeny of homothallic matings can mate with diploid cells of the opposite mating type, generating unstable genomes that give rise to diverse offspring


Du et al., 2018 Alby and Bennett, 2010 (review)

C. parapsilosis

  • Never observed to mate


Alby and Bennett, 2010 (review)

C. glabrata

  • Never observed to mate
  • However, there is genomic evidence for past recombination events and the genome contains the factors shown necessary for meiosis in the close relative S. cerevisiae


Dodgson et al., 2005 Bedekovic and Usher, 2023 (review)

C. auris

  • Never observed to mate
  • However, there is evidence in the genome for past recombination events, especially from before the clades split, and the species appears to contain the necessary factors for mating/meiosis


Muñoz et al., 2018

Drug resistance

Notes: Candida species show distinct drug resistance profiles. While all species can acquire resistance, inherent resistance and/or tolerance is especially concerning for C. auris and C. glabrata, likely due to their haploid genomes.

References:

Concerning levels of inherent azole resistance

  • C. glabrata
  • C. auris
  • C. krusei

Concerning levels of inherent echinocandin resistance

  • C. glabrata
  • C. auris

Concerning levels of amphotericin B resistance

  • C. auris

Acquired resistance in nosocomial settings

  • All species

Resistance within biofilms

  • All species

Respiratory metabolism

Notes: The Crabtree effect explains why baker’s yeast is also called brewer’s yeast, in that S. cerevisiae preferentially converts sugar to alcohol in lieu of other types of respiration. This is referred to as Crabtree positive. Among the pathogenic yeasts, the only member with this ability is the phylogenetic outlier C. glabrata, which is more closely related to S. cerevisiae than to the other pathogenic yeasts. The other pathogenic yeasts are all Crabtree negative, meaning they do not produce alcohol as a product of respiration. For these non-fermentative yeasts, the ability to utilize many carbon sources (with little preference for glucose) is thought to provide an advantage for pathogenesis in various host niches.

References

Crabtree negative (non-fermentative)

  • C. albicans
  • C. dubliniensis
  • C. parapsilosis
  • C. tropicalis
  • C. auris

Crabtree positive (fermentative)

  • C. glabrata

Virulence Factors

Notes: Pathogenic yeasts vary in use of secreted and membrane-bound virulence factors involved in invasion, damage and translocation.

References

From Lim et al., 2021

Datasets Available in CGD

NOTE: To access a specific dataset in JBrowse, click "Select Tracks" at the upper left of the JBrowse page for the species and choose the dataset by first author name.

C. albicans in JBrowse

  • Bruno et al., 2010. Comprehensive annotation of the transcriptome of the human fungal pathogen Candida albicans using RNA-seq. Genome Res. 2010 Oct;20(10):1451-8.
  • Butler et al., 2009. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature. 2009 Jun 4;459(7247):657-62.
  • Desai et al., 2013. Regulatory role of glycerol in Candida albicans biofilm formation. mBio. 2013 Apr 9;4(2):e00637-12.
  • Lohse and Johnson, 2016. Identification and characterization of Wor4, a new transcriptional regulator of white-opaque switching. G3 (Bethesda). 2016 Jan 15;6(3):721-9
  • Muzzy et al., 2013. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biol. 2013;14(9):R97.
  • Niemec et al., 2017. Dual transcriptome of the immediate neutrophil and Candida albicans interplay. BMC Genomics. 2017 Sep 6;18(1):696.
  • Segal et al., 2018. Gene essentiality analyzed by in vivo transposon mutagenesis and machine learning in a stable haploid isolate of Candida albicans. mBio. 2018 Oct 30;9(5):e02048-18.
  • Xie et al., 2013. White-opaque switching in natural MTLa/α isolates of Candida albicans: evolutionary implications for roles in host adaptation, pathogenesis, and sex. PLoS Biol. 2013;11(3):e1001525.
  • Glazier et al., 2023. The Candida albicans reference strain SC5314 contains a rare, dominant allele of the transcription factor Rob1 that modulates filamentation, biofilm formation, and oral commensalism. mBio. 2023 Oct 31;14(5):e0152123.
  • Shivarathri et al., 2019. The fungal histone acetyl transferase Gcn5 controls virulence of the human pathogen Candida albicans through multiple pathways. Sci Rep. 2019 Jul 1;9(1):9445.
  • Rai, et al., 2024. Metabolic reprogramming during Candida albicans planktonic-biofilm transition is modulated by the transcription factors Zcf15 and Zcf26. PLoS Biol. 2024 Jun 21;22(6):e3002693.
  • Zhang, et al. 2024. DNA damage checkpoints govern global gene transcription and exhibit species-specific regulation on HOF1 in Candida albicans. J Fungi (Basel). 2024 May 29;10(6):387.

C. parapsilosis in JBrowse

  • Connolly, et al., 2013. The APSES transcription factor Efg1 is a global regulator that controls morphogenesis and biofilm formation in Candida parapsilosis. Mol Microbiol. 2013 Oct;90(1):36-53.
  • Guida et al., 2011. Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast Candida parapsilosis. BMC Genomics. 2011 Dec 22:12:628.

C. dubliniensis in JBrowse

  • Grumaz et al., 2013. Species and condition specific adaptation of the transcriptional landscapes in Candida albicans and Candida dubliniensis. BMC Genomics. 2013 Apr 2:14:212.
  • Singh-Babakh et al., 2021. Lineage-specific selection and the evolution of virulence in the Candida clade. Proc Natl Acad Sci U S A. 2021 Mar 23;118(12):e2016818118.

C. glabrata in JBrowse

  • Vu, et al., 2021. The Candida glabrata Upc2A transcription factor is a global regulator of antifungal drug resistance pathways. PLoS Genet. 2021 Sep 30;17(9):e1009582.
  • Ni, et al., 2023. The regulatory subunits of CK2 complex mediate DNA damage response and virulence in Candida glabrata. BMC Microbiol. 2023 Oct 28;23(1):317.
  • Kumar, et al., 2024. SWI/SNF complex-mediated chromatin remodeling in Candida glabrata promotes immune evasion. iScience. 2024 Mar 27;27(4):109607.
  • Bhakt et al., 2022. The SET-domain protein CgSet4 negatively regulates antifungal drug resistance via the ergosterol biosynthesis transcriptional regulator CgUpc2a. J Biol Chem. 2022 Oct;298(10):102485.
  • Linde et al., 2015. Defining the transcriptomic landscape of Candida glabrata by RNA-Seq. Nucleic Acids Res. 2015 Feb 18;43(3):1392-406.

C. auris in JBrowse

  • Simm, et al., 2022. Disruption of iron homeostasis and mitochondrial metabolism are promising targets to inhibit Candida auris. Microbiol Spectr 2022 Apr 27;10(2):e0010022.
  • Jakab, et al., 2021. Transcriptional profiling of the Candida auris response to exogenous farnesol exposure mSphere. 2021 Sep-Oct; 6(5): e00710-21.
  • Biermann and Hogan, 2022 Transcriptional response of Candida auris to the Mrr1 inducers methylglyoxal and benomyl. mSphere 2022 Jun 29;7(3):e0012422.
  • Balla, et al., 2023. Total transcriptome analysis of Candida auris planktonic cells exposed to tyrosol. AMB Express 2023 Aug 2;13(1):81.
  • Jenull et al., 2021. Transcriptome signatures predict phenotypic variations of Candida auris. Front Cell Infect Microbiol 2021 Apr 14:11:662563.
  • Chow et al., 2023. The transcription factor Rpn4 activates its own transcription and induces efflux pump expression to confer fluconazole resistance in Candida auris. mBio 2023 Nov 28;14(6):e0268823
  • Shivarathri, et al., 2022. Comparative transcriptomics reveal possible mechanisms of amphotericin B resistance in Candida auris. Antimicrob Agents Chemother. 2022 Jun 21;66(6):e0227621.
  • Pelletier, et al., 2024. Candida auris undergoes adhesin-dependent and -independent cellular aggregation. PLoS Pathog. 2024 Mar 11;20(3):e1012076

Community Resources