Main Page: Difference between revisions

From CGD Public Wiki
 
(52 intermediate revisions by 2 users not shown)
Line 4: Line 4:
=Seminal Candida Papers =
=Seminal Candida Papers =
==<i>C. albicans</i>==
==<i>C. albicans</i>==
<div class="mw-collapsible mw-collapsed">


===Cell Biology===
===Cell Biology===
Line 123: Line 124:
*[https://pubmed.ncbi.nlm.nih.gov/17506678/ Whiteway M, Bachewich C]. Morphogenesis in <i>Candida albicans</i>. Annu Rev Microbiol. 2007;61:529-53.
*[https://pubmed.ncbi.nlm.nih.gov/17506678/ Whiteway M, Bachewich C]. Morphogenesis in <i>Candida albicans</i>. Annu Rev Microbiol. 2007;61:529-53.
*[https://pubmed.ncbi.nlm.nih.gov/32784532/ Du H, Ennis CL, Hernday AD, Nobile CJ, Huang G]. N-Acetylglucosamine (GlcNAc) Sensing, Utilization, and Functions in <i>Candida albicans</i>. J Fungi (Basel). 2020 Aug 7;6(3):129.
*[https://pubmed.ncbi.nlm.nih.gov/32784532/ Du H, Ennis CL, Hernday AD, Nobile CJ, Huang G]. N-Acetylglucosamine (GlcNAc) Sensing, Utilization, and Functions in <i>Candida albicans</i>. J Fungi (Basel). 2020 Aug 7;6(3):129.


WHITE-OPAQUE SWITCHING
WHITE-OPAQUE SWITCHING
Line 158: Line 158:
*[https://pubmed.ncbi.nlm.nih.gov/19656200/ Roman E, Alonso-Monge R, Gong Q, Li D, Calderone R, Pla J]. The Cek1 MAPK is a short-lived protein regulated by quorum sensing in the fungal pathogen <i>Candida albicans</i>. FEMS Yeast Res. 2009 Sep;9(6):942-55.
*[https://pubmed.ncbi.nlm.nih.gov/19656200/ Roman E, Alonso-Monge R, Gong Q, Li D, Calderone R, Pla J]. The Cek1 MAPK is a short-lived protein regulated by quorum sensing in the fungal pathogen <i>Candida albicans</i>. FEMS Yeast Res. 2009 Sep;9(6):942-55.
*[https://pubmed.ncbi.nlm.nih.gov/19933803/ Langford ML, Hasim S, Nickerson KW, Atkin AL]. Activity and toxicity of farnesol towards <i>Candida albicans</i> are dependent on growth conditions. Antimicrob Agents Chemother. 2010 Feb;54(2):940-2.
*[https://pubmed.ncbi.nlm.nih.gov/19933803/ Langford ML, Hasim S, Nickerson KW, Atkin AL]. Activity and toxicity of farnesol towards <i>Candida albicans</i> are dependent on growth conditions. Antimicrob Agents Chemother. 2010 Feb;54(2):940-2.


STRESS RESPONSES
STRESS RESPONSES
Line 167: Line 166:
*[https://pubmed.ncbi.nlm.nih.gov/19759180/ Rodaki A, Bohovych IM, Enjalbert B, Young T, Odds FC, Gow NA, Brown AJ]. Glucose promotes stress resistance in the fungal pathogen <i>Candida albicans</i>. Mol Biol Cell. 2009 Nov;20(22):4845-55.
*[https://pubmed.ncbi.nlm.nih.gov/19759180/ Rodaki A, Bohovych IM, Enjalbert B, Young T, Odds FC, Gow NA, Brown AJ]. Glucose promotes stress resistance in the fungal pathogen <i>Candida albicans</i>. Mol Biol Cell. 2009 Nov;20(22):4845-55.
*[https://pubmed.ncbi.nlm.nih.gov/26945893/ Berman J]. Ploidy plasticity: a rapid and reversible strategy for adaptation to stress. FEMS Yeast Res. 2016 May;16(3):fow020.
*[https://pubmed.ncbi.nlm.nih.gov/26945893/ Berman J]. Ploidy plasticity: a rapid and reversible strategy for adaptation to stress. FEMS Yeast Res. 2016 May;16(3):fow020.


THIGMOTROPISM, GALVANOTROPISM AND CONTACT-SENSING
THIGMOTROPISM, GALVANOTROPISM AND CONTACT-SENSING
Line 209: Line 207:
*[https://pubmed.ncbi.nlm.nih.gov/17321137/ Roman E, Arana DM, Nombela C, Alonso-Monge R, Pla J]. MAP kinase pathways as regulators of fungal virulence. Trends Microbiol. 2007 Apr;15(4):181-90.
*[https://pubmed.ncbi.nlm.nih.gov/17321137/ Roman E, Arana DM, Nombela C, Alonso-Monge R, Pla J]. MAP kinase pathways as regulators of fungal virulence. Trends Microbiol. 2007 Apr;15(4):181-90.
*[https://pubmed.ncbi.nlm.nih.gov/16262871/ Schaller M, Borelli C, Korting HC, Hube B]. Hydrolytic enzymes as virulence factors of <i>Candida albicans</i>. Mycoses. 2005 Nov;48(6):365-77.
*[https://pubmed.ncbi.nlm.nih.gov/16262871/ Schaller M, Borelli C, Korting HC, Hube B]. Hydrolytic enzymes as virulence factors of <i>Candida albicans</i>. Mycoses. 2005 Nov;48(6):365-77.
 
</div>
==<i>C. glabrata</i>==
==<i>C. glabrata</i>==
<div class="mw-collapsible mw-collapsed">


===Cell Biology===
===Cell Biology===
CELL WALL
CELL WALL
*[https://pubmed.ncbi.nlm.nih.gov/10417386/ Cormack BP, Ghori, N, Falkow S]. An adhesin of the yeast pathogen Candida glabrata mediating adherence to human epithelial cells. Science 1999 Jul 23;285(5427);578-82.
*[https://pubmed.ncbi.nlm.nih.gov/10417386/ Cormack BP, Ghori, N, Falkow S]. An adhesin of the yeast pathogen Candida glabrata mediating adherence to human epithelial cells. Science 1999 Jul 23;285(5427);578-82.
Line 254: Line 254:
*[https://pubmed.ncbi.nlm.nih.gov/18957584/ Srikantha T, Daniels KJ, Wu W, Lockhart SR, Yi S, Sahni N, Ma N, Soll DR]. Dark brown is the more virulent of the switch phenotypes of Candida glabrata. Microbiology. 2008 Nov;154(Pt 11):3309-18.
*[https://pubmed.ncbi.nlm.nih.gov/18957584/ Srikantha T, Daniels KJ, Wu W, Lockhart SR, Yi S, Sahni N, Ma N, Soll DR]. Dark brown is the more virulent of the switch phenotypes of Candida glabrata. Microbiology. 2008 Nov;154(Pt 11):3309-18.
*[https://pubmed.ncbi.nlm.nih.gov/16087748/ Srikantha T, Zhao R, Daniels K, Radke J, Soll DR]. Phenotypic switching in Candida glabrata accompanied by changes in expression of genes with deduced functions in copper detoxification and stress. Eukaryot Cell. 2005 Aug;4(8):1434-45.
*[https://pubmed.ncbi.nlm.nih.gov/16087748/ Srikantha T, Zhao R, Daniels K, Radke J, Soll DR]. Phenotypic switching in Candida glabrata accompanied by changes in expression of genes with deduced functions in copper detoxification and stress. Eukaryot Cell. 2005 Aug;4(8):1434-45.


===Virulence===
===Virulence===
Line 274: Line 272:
*[https://pubmed.ncbi.nlm.nih.gov/15075283/ Kamran M, Calcagno AM, Findon H, Bignell E, Jones MD, Warn P, Hopkins P, Denning DW, Butler G, Rogers T, Mühlschlegel FA, Haynes K]. Inactivation of transcription factor gene ACE2 in the fungal pathogen Candida glabrata results in hypervirulence. Eukaryot Cell. 2004 Apr;3(2):546-52.
*[https://pubmed.ncbi.nlm.nih.gov/15075283/ Kamran M, Calcagno AM, Findon H, Bignell E, Jones MD, Warn P, Hopkins P, Denning DW, Butler G, Rogers T, Mühlschlegel FA, Haynes K]. Inactivation of transcription factor gene ACE2 in the fungal pathogen Candida glabrata results in hypervirulence. Eukaryot Cell. 2004 Apr;3(2):546-52.
*[https://pubmed.ncbi.nlm.nih.gov/20008535/ Jacobsen ID, Brunke S, Seider K, Schwarzmüller T, Firon A, d'Enfért C, Kuchler K, Hube B]. Candida glabrata persistence in mice does not depend on host immunosuppression and is unaffected by fungal amino acid auxotrophy. Infect Immun. 2010 Mar;78(3):1066-77.
*[https://pubmed.ncbi.nlm.nih.gov/20008535/ Jacobsen ID, Brunke S, Seider K, Schwarzmüller T, Firon A, d'Enfért C, Kuchler K, Hube B]. Candida glabrata persistence in mice does not depend on host immunosuppression and is unaffected by fungal amino acid auxotrophy. Infect Immun. 2010 Mar;78(3):1066-77.
</div>
==<i>C. parapsilosis</i>==
<div class="mw-collapsible mw-collapsed">
===Cell Biology===
CELL WALL
*[https://pubmed.ncbi.nlm.nih.gov/21953587/ Vinterová Z, Sanda M, Dostál J, Hrušková-Heidingsfeldová O, Pichová I]. Evidence for the presence of proteolytically active secreted aspartic proteinase 1 of <i>Candida parapsilosis</i> in the cell wall. Protein Sci. 2011 Dec;20(12):2004-12.
*[https://pubmed.ncbi.nlm.nih.gov/26438063/ Kozik A, Karkowska-Kuleta J, Zajac D, Bochenska O, Kedracka-Krok S, Jankowska U, Rapala-Kozik M]. Fibronectin-, vitronectin- and laminin-binding proteins at the cell walls of <i>Candida parapsilosis</i> and <i>Candida tropicalis</i> pathogenic yeasts. BMC Microbiol. 2015 Oct 5;15:197.
*[https://pubmed.ncbi.nlm.nih.gov/26636137/ Karkowska-Kuleta J, Zajac D, Bochenska O, Kozik A]. Surfaceome of pathogenic yeasts, <i>Candida parapsilosis</i> and <i>Candida tropicalis</i>, revealed with the use of cell surface shaving method and shotgun proteomic approach. Acta Biochim Pol. 2015;62(4):807-19.
*[https://pubmed.ncbi.nlm.nih.gov/27014229/ Pérez-García LA, Csonka K, Flores-Carreón A, Estrada-Mata E, Mellado-Mojica E, Németh T, López-Ramírez LA, Toth R, López MG, Vizler C, Marton A, Tóth A, Nosanchuk JD, Gácser A, Mora-Montes HM].  Role of protein glycosylation in <i>Candida parapsilosis</i>  cell wall integrity and host interaction. Front Microbiol. 2016 Mar 8:7:306.
*[https://pubmed.ncbi.nlm.nih.gov/31105652/ Oh SH, Smith B, Miller AN, Staker B, Fields C, Hernandez A, Hoyer LL]. Agglutinin-Like Sequence (ALS) Genes in the <i>Candida parapsilosis</i>  species complex: blurring the boundaries between gene families that encode cell-wall proteins. Front Microbiol. 2019 Apr 26:10:781.
*[https://pubmed.ncbi.nlm.nih.gov/36851809/ Satala D, Karkowska-Kuleta J, Bras G, Rapala-Kozik M, Kozik A]. <i>Candida parapsilosis</i> cell wall proteins-CPAR2_404800 and CPAR2_404780-are adhesins that bind to human epithelial and endothelial cells and extracellular matrix proteins. Yeast. 2023 Aug;40(8):377-389.
*[https://pubmed.ncbi.nlm.nih.gov/36992262/ Gong X, Srivastava V, Naicker P, Khan A, Ahmad A]. <i>Candida parapsilosis</i> cell wall proteome characterization and effectiveness against hematogenously disseminated candidiasis in a murine model. Vaccines (Basel). 2023 Mar 16;11(3):674.
DRUG RESISTANCE MECHANISMS
*[https://pubmed.ncbi.nlm.nih.gov/36121151/ Bergin SA, Zhao F, Ryan AP, Müller CA, Nieduszynski CA, Zhai B, Rolling T, Hohl TM, Morio F, Scully J, Wolfe KH, Butler G]. Systematic analysis of copy number variations in the pathogenic yeast <i>Candida parapsilosis</i> identifies a gene amplification in <i> RTA3</i> that is associated with drug resistance. mBio. 2022 Oct 26;13(5):e0177722.
*[https://pubmed.ncbi.nlm.nih.gov/33115837/ Papp C, Bohner F, Kocsis K, Varga M, Szekeres A, Bodai L, Willis JR, Gabaldón T, Tóth R, Nosanchuk JD, Vágvölgyi C, Gácser A].
*[https://pubmed.ncbi.nlm.nih.gov/26248365/ Branco J, Silva AP, Silva RM, Silva-Dias A, Pina-Vaz C, Butler G, Rodrigues AG, Miranda IM]. Fluconazole and voriconazole resistance in <i>Candida parapsilosis</i> is conferred by gain-of-function mutations in <i>MRR1</i> transcription factor gene. Antimicrob Agents Chemother. 2015 Oct;59(10):6629-33.
*[https://pubmed.ncbi.nlm.nih.gov/36675901/ Branco J, Miranda IM, Rodrigues AG]. <i>Candida parapsilosis</i> Virulence and antifungal resistance mechanisms: a comprehensive review of key determinants. J Fungi (Basel). 2023 Jan 5;9(1):80.
*[https://pubmed.ncbi.nlm.nih.gov/15956390/ Sarvikivi E, Lyytikäinen O, Soll DR]. Emergence of fluconazole resistance in a <i>Candida parapsilosis</i> strain that caused infections in a neonatal intensive care unit. J Clin Microbiol. 2005;43(6):2729–2735.
===Transformation/Response===
BIOFILMS
*[https://pubmed.ncbi.nlm.nih.gov/26071437/ Pereira L, Silva S, Ribeiro B, Henriques M, Azeredo J]. Influence of glucose concentration on the structure and quantity of biofilms formed by <i>Candida parapsilosis</i>. FEMS Yeast Res. 2015 Aug;15(5):fov043.
*[https://pubmed.ncbi.nlm.nih.gov/23895281/ Connolly LA, Riccombeni A, Grózer Z, Holland LM, Lynch DB, Andes DR, Gácser A, Butler G]. The APSES transcription factor <i>Efg1</i> is a global regulator that controls morphogenesis and biofilm formation in <i>Candida parapsilosis. </i> Mol Microbiol. 2013 Oct;90(1):36-53.
*[https://pubmed.ncbi.nlm.nih.gov/33538224/ Branco J, Martins-Cruz C, Rodrigues L, Silva RM, Araújo-Gomes N, Gonçalves T, Miranda IM, Rodrigues AG]. The transcription factor <i>Ndt80</i> is a repressor of <i>Candida parapsilosis</i> virulence attributes. Virulence. 2021 Dec;12(1):601-614.
*[https://pubmed.ncbi.nlm.nih.gov/25233198/ Holland LM, Schröder MS, Turner SA, Taff H, Andes D, Grózer Z, Gácser A, Ames L, Haynes K, Higgins DG, Butler G]. Comparative phenotypic analysis of the major fungal pathogens <i>Candida parapsilosis</i> and <i>Candida albicans</i>. PLoS Pathog. 2014 Sep 18;10(9):e1004365.
ADHESION
*[https://pubmed.ncbi.nlm.nih.gov/33568454/ Bliss JM, Tollefson GA, Cuevas A, Longley SJ, Neale MN, Uzun A, Shaw SK]. Transcription profiles associated with inducible adhesion in <i>Candida parapsilosis</i>. mSphere. 2021 Feb 10;6(1):e01071-20.
MATING LOCI
*[https://pubmed.ncbi.nlm.nih.gov/15947193/ Logue ME, Wong S, Wolfe KH, Butler G]. A genome sequence survey shows that the pathogenic yeast <i>Candida parapsilosis</i> has a defective <i>MTLa1</i> allele at its mating type locus. Eukaryot Cell. 2005 Jun;4(6):1009-17.
*[https://pubmed.ncbi.nlm.nih.gov/21335529/ Sai S, Holland LM, McGee CF, Lynch DB, Butler G]. Evolution of mating within the <i>Candida parapsilosis</i> species group. Eukaryot Cell. 2011 Apr;10(4):578-87.
*[https://pubmed.ncbi.nlm.nih.gov/28771588/ Döğen A, Metin B, Ilkit M, de Hoog GS, Heitman J]. MTL genotypes, phenotypic switching, and susceptibility profiles of <i>Candida parapsilosis</i> species group compared to <i>Lodderomyces elongisporus</i>. PLoS One. 2017 Aug 3;12(8):e0182653.
PHENOTYPIC SWITCHING
*[https://pubmed.ncbi.nlm.nih.gov/15817776/ Laffey SF, Butler G]. Phenotype switching affects biofilm formation by <i>Candida parapsilosis</i>. Microbiology (Reading). 2005 Apr;151(Pt 4):1073-1081.
*[https://pubmed.ncbi.nlm.nih.gov/33572958/ Pál SE, Tóth R, Nosanchuk JD, Vágvölgyi C, Németh T, Gácser A]. A <i>Candida parapsilosis</i> overexpression collection reveals genes required for pathogenesis. J Fungi (Basel). 2021 Jan 29;7(2):97.
STRESS RESPONSE
*[https://pubmed.ncbi.nlm.nih.gov/24922533/ Sánchez-Fresneda R, Martínez-Esparza M, Maicas S, Argüelles JC, Valentín E]. In <i>Candida parapsilosis</i> the <i>ATC1</i> gene encodes for an acid trehalase involved in trehalose hydrolysis, stress resistance and virulence. PLoS One. 2014 Jun 12;9(6):e99113.
*[https://pubmed.ncbi.nlm.nih.gov/31399405/ Jakab Á, Tóth Z, Nagy F, Nemes D, Bácskay I, Kardos G, Emri T, Pócsi I, Majoros L, Kovács R]. Physiological and transcriptional responses of <i>Candida parapsilosis</i> to exogenous tyrosol. Appl Environ Microbiol. 2019 Oct 1;85(20):e01388-19.
*[https://pubmed.ncbi.nlm.nih.gov/33302409/ Zangl I, Beyer R, Pap IJ, Strauss J, Aspöck C, Willinger B, Schüller C]. Human pathogenic <i>Candida</i> species respond distinctively to lactic acid stress. J Fungi (Basel). 2020 Dec 8;6(4):348.


==<i>C. parapsilosis</i>==
===Virulence===
HOST-PATHOGEN INTERACTIONS
*[https://pubmed.ncbi.nlm.nih.gov/29358719/ Tóth R, Cabral V, Thuer E, Bohner F, Németh T, Papp C, Nimrichter L, Molnár G, Vágvölgyi C, Gabaldón T, Nosanchuk JD, Gácser A]. Investigation of <i>Candida parapsilosis</i> virulence regulatory factors during host-pathogen interaction. Sci Rep. 2018 Jan 22;8(1):1346.
*[https://pubmed.ncbi.nlm.nih.gov/33572958/ Pál SE, Tóth R, Nosanchuk JD, Vágvölgyi C, Németh T, Gácser A]. A <i>Candida parapsilosis</i> Overexpression collection reveals genes required for pathogenesis. J Fungi (Basel). 2021 Jan 29;7(2):97.
*[https://pubmed.ncbi.nlm.nih.gov/24257473/ Singaravelu K, Gácser A, Nosanchuk JD]. Genetic determinants of virulence - <i>Candida parapsilosis</i>. Rev Iberoam Micol. 2014 Jan-Mar;31(1):16-21.
*[https://pubmed.ncbi.nlm.nih.gov/25911234/ Polke M, Hube B, Jacobsen ID]. <i>Candida</i> survival strategies. Adv Appl Microbiol. 2015:91:139-235. [REVIEW]
*[https://pubmed.ncbi.nlm.nih.gov/21569057/ Silva S, Negri M, Henriques M, Oliveira R, Williams DW, Azeredo J]. <i>Candida glabrata, Candida parapsilosis</i> and <i>Candida tropicalis</i>: biology, epidemiology, pathogenicity and antifungal resistance. FEMS Microbiol Rev. 2012 Mar;36(2):288-305. [REVIEW]
 
VIRULENCE FACTORS
*[https://pubmed.ncbi.nlm.nih.gov/8335087/ Fusek M, Smith EA, Monod M, Foundling SI]. <i>Candida parapsilosis</i> expresses and secretes two aspartic proteinases. FEBS Lett. 1993 Jul 19;327(1):108-12.
*[https://pubmed.ncbi.nlm.nih.gov/36675901/ Branco J, Miranda IM, Rodrigues AG]. <i>Candida parapsilosis</i> Virulence and antifungal resistance mechanisms: a comprehensive review of key determinants. J Fungi (Basel). 2023 Jan 5;9(1):80.
*[https://pubmed.ncbi.nlm.nih.gov/27526931/ Toth R, Toth A, Vagvolgyi C, Gacser A]. <i>Candida parapsilosis</i> Secreted lipase as an important virulence factor. Curr Protein Pept Sci. 2017;18(10):1043-1049.
*[https://pubmed.ncbi.nlm.nih.gov/38918050/ Gandra RM, Ramos LS, Cruz LPS, Souza LOP, Branquinha MH, Santos ALS]. <i>Candida parapsilosis</i>: Heterogeneous and strain-specific expression of secreted aspartic proteases (Sapp1 and Sapp2). Med Mycol. 2024 Jul 4;62(7):myae066.
</div>
==<i>C. auris</i>==
==<i>C. auris</i>==
<div class="mw-collapsible mw-collapsed">
===Cell Biology===
CELL WALL
*[https://pubmed.ncbi.nlm.nih.gov/34160238/ Horton MV, Johnson CJ, Zarnowski R, Andes BD, Schoen TJ, Kernien JF, Lowman D, Kruppa MD, Ma Z, Williams DL, Huttenlocher A, Nett JE]. <i>Candida auris</i> cell wall mannosylation contributes to neutrophil evasion through pathways divergent from <i>Candida albicans</i> and <i>Candida glabrata</i>. mSphere. 2021 Jun 30;6(3):e0040621.
*[https://pubmed.ncbi.nlm.nih.gov/38851008/ Dakalbab S, Hamdy R, Holigová P, Abuzaid EJ, Abu-Qiyas A, Lashine Y, Mohammad MG, Soliman SSM]. Uniqueness of <i>Candida auris</i> cell wall in morphogenesis, virulence, resistance, and immune evasion. Microbiol Res. 2024 Sep;286:127797.
*[https://pubmed.ncbi.nlm.nih.gov/39656857/ Alvarado M, Gómez-Navajas JA, Blázquez-Muñoz MT, Gómez-Molero E, Fernández-Sánchez S, Eraso E, Munro CA, Valentín E, Mateo E, de Groot PWJ]. The good, the bad, and the hazardous: comparative genomic analysis unveils cell wall features in the pathogen <i>Candidozyma auris</i> typical for both baker's yeast and <i>Candida</i>. FEMS Yeast Res. 2024 Jan 9;24:foae039.
DRUG RESISTANCE MECHANISMS
*[https://pubmed.ncbi.nlm.nih.gov/35252632/ Shahi G, Kumar M, Skwarecki AS, Edmondson M, Banerjee A, Usher J, Gow NAR, Milewski S, Prasad R]. Fluconazole resistant <i>Candida auris</i> clinical isolates have increased levels of cell wall chitin and increased susceptibility to a glucosamine-6-phosphate synthase inhibitor. Cell Surf. 2022 Feb 25;8:100076.
*[https://pubmed.ncbi.nlm.nih.gov/35770999/ Jacobs SE, Jacobs JL, Dennis EK, Taimur S, Rana M, Patel D, Gitman M, Patel G, Schaefer S, Iyer K, Moon J, Adams V, Lerner P, Walsh TJ, Zhu Y, Anower MR, Vaidya MM, Chaturvedi S, Chaturvedi V]. <i>Candida auris</i> pan-drug-resistant to four classes of antifungal agents. Antimicrob Agents Chemother. 2022 Jul 19;66(7):e0005322.
*[https://pubmed.ncbi.nlm.nih.gov/33820824/ Carolus H, Pierson S, Muñoz JF, Subotić A, Cruz RB, Cuomo CA, Van Dijck P]. Genome-wide analysis of experimentally evolved <i>Candida auris</i> reveals multiple novel mechanisms of multidrug resistance. mBio. 2021 Apr 5;12(2):e03333-20.
*[https://pubmed.ncbi.nlm.nih.gov/37337929/ Jangir P, Kalra S, Tanwar S, Bari VK]. Azole resistance in <i>Candida auris</i>: mechanisms and combinatorial therapy. APMIS. 2023 Aug;131(8):442-462.
*[https://pubmed.ncbi.nlm.nih.gov/35794716/  Sanyaolu A, Okorie C, Marinkovic A, Abbasi AF, Prakash S, Mangat J, Hosein Z, Haider N, Chan J]. <i>Candida auris</i>: An overview of the emerging drug-resistant fungal infection. Infect Chemother. 2022 Jun;54(2):236-246. [Review]
*[https://pubmed.ncbi.nlm.nih.gov/33091071/ Du H, Bing J, Hu T, Ennis CL, Nobile CJ, Huang G]. <i>Candida auris</i>: Epidemiology, biology, antifungal resistance, and virulence. PLoS Pathog. 2020 Oct 22;16(10):e1008921. [Review]
*[https://pubmed.ncbi.nlm.nih.gov/37998390/ Czajka KM, Venkataraman K, Brabant-Kirwan D, Santi SA, Verschoor C, Appanna VD, Singh R, Saunders DP, Tharmalingam S]. Molecular mechanisms associated with antifungal resistance in pathogenic <i>Candida</i> species. Cells. 2023 Nov 19;12(22):2655. [Review]
*[https://pubmed.ncbi.nlm.nih.gov/38686214/ Lee Y, Robbins N, Cowen LE]. Molecular mechanisms governing antifungal drug resistance. NPJ Antimicrob Resist. 2023;1(1):5. [Review]
===Transformation/Response===
BIOFILMS
*[https://pubmed.ncbi.nlm.nih.gov/31969479/ Horton MV, Johnson CJ, Kernien JF, Patel TD, Lam BC, Cheong JZA, Meudt JJ, Shanmuganayagam D, Kalan LR, Nett JE]. <i>Candida auris</i> forms high-burden biofilms in skin niche conditions and on porcine skin. mSphere. 2020 Jan 22;5(1):e00910-19.
*[https://pubmed.ncbi.nlm.nih.gov/35674961/ Corzo-León DE, Mark C, MacCallum DM, Munro CA]. A human ex vivo skin model to study <i>Candida auris</i> biofilms. Methods Mol Biol. 2022;2517:259-267.
*[https://pubmed.ncbi.nlm.nih.gov/34540717/ Bapat PS, Nobile CJ]. Photodynamic therapy is effective against <i>Candida auris</i> biofilms. Front Cell Infect Microbiol. 2021 Sep 3;11:713092.
*[https://pubmed.ncbi.nlm.nih.gov/38493178/ Bing J, Guan Z, Zheng T, Ennis CL, Nobile CJ, Chen C, Chu H, Huang G]. Rapid evolution of an adaptive multicellular morphology of <i>Candida auris</i> during systemic infection. Nat Commun. 2024 Mar 16;15(1):2381.
ADHESION
*[https://pubmed.ncbi.nlm.nih.gov/37769084/ Santana DJ, Anku JAE, Zhao G, Zarnowski R, Johnson CJ, Hautau H, Visser ND, Ibrahim AS, Andes D, Nett JE, Singh S, O'Meara TR]. A <i>Candida auris</i>-specific adhesin, Scf1, governs surface association, colonization, and virulence. Science. 2023 Sep 29;381(6665):1461-1467.
*[https://pubmed.ncbi.nlm.nih.gov/39455573/ Wang TW, Sofras D, Montelongo-Jauregui D, Paiva TO, Carolus H, Dufrêne YF, Alfaifi AA, McCracken C, Bruno VM, Van Dijck P, Jabra-Rizk MA]. Functional redundancy in <i>Candida auris</i> cell surface adhesins crucial for cell-cell interaction and aggregation. Nat Commun. 2024 Oct 25;15(1):9212.
MATING LOCI
*[https://pubmed.ncbi.nlm.nih.gov/30559369/ Muñoz JF, Gade L, Chow NA, Loparev VN, Juieng P, Berkow EL, Farrer RA, Litvintseva AP, Cuomo CA]. Genomic insights into multidrug-resistance, mating and virulence in <i>Candida auris</i> and related emerging species. Nat Commun. 2018 Dec 17;9(1):5346.
*[https://pubmed.ncbi.nlm.nih.gov/35782746/ Wang Y, Xu J]. Population genomic analyses reveal evidence for limited recombination in the superbug <i>Candida auris</i> in nature. Comput Struct Biotechnol J. 2022 Jun 16;20:3030-3040.
PHENOTYPIC SWITCHING
*[https://pubmed.ncbi.nlm.nih.gov/30482894/ Yue H, Bing J, Zheng Q, Zhang Y, Hu T, Du H, Wang H, Huang G]. Filamentation in <i>Candida auris</i>, an emerging fungal pathogen of humans: passage through the mammalian body induces a heritable phenotypic switch. Emerg Microbes Infect. 2018 Nov 28;7(1):188.
*[https://pubmed.ncbi.nlm.nih.gov/30329075/ Bentz ML, Sexton DJ, Welsh RM, Litvintseva AP]. Phenotypic switching in newly emerged multidrug-resistant pathogen <i>Candida auris</i>. Med Mycol. 2019 Jul 1;57(5):636-638.
*[https://pubmed.ncbi.nlm.nih.gov/39405274/ Phan-Canh T, Kuchler K]. Do morphogenetic switching and intraspecies variation enhance virulence of <i>Candida auris</i>? PLoS Pathog. 2024 Oct 15;20(10):e1012559. [Review]
STRESS RESPONSE
*[https://pubmed.ncbi.nlm.nih.gov/34643421/ Jakab Á, Balla N, Ragyák Á, Nagy F, Kovács F, Sajtos Z, Tóth Z, Borman AM, Pócsi I, Baranyai E, Majoros L, Kovács R]. Transcriptional profiling of the <i>Candida auris</i> response to exogenous farnesol exposure. mSphere. 2021 Oct 27;6(5):e0071021.
*[https://pubmed.ncbi.nlm.nih.gov/34630944/ Zamith-Miranda D, Amatuzzi RF, Munhoz da Rocha IF, Martins ST, Lucena ACR, Vieira AZ, Trentin G, Almeida F, Rodrigues ML, Nakayasu ES, Nosanchuk JD, Alves LR]. Transcriptional and translational landscape of <i>Candida auris</i> in response to caspofungin. Comput Struct Biotechnol J. 2021 Sep 14;19:5264-5277.
===Virulence===
HOST-PATHOGEN INTERACTIONS
*[https://pubmed.ncbi.nlm.nih.gov/33190684/ Chaturvedi V, Linhardt RJ, Papon N]. <i>Candida auris</i> mannans and pathogen-host interplay. Trends Microbiol. 2020 Dec;28(12):954-956.
*[https://pubmed.ncbi.nlm.nih.gov/38493178/ Bing J, Guan Z, Zheng T, Ennis CL, Nobile CJ, Chen C, Chu H, Huang G]. Rapid evolution of an adaptive multicellular morphology of <i>Candida auris</i> during systemic infection. Nat Commun. 2024 Mar 16;15(1):2381.
*[https://pubmed.ncbi.nlm.nih.gov/37204928/ Weerasinghe H, Simm C, Djajawi TM, Tedja I, Lo TL, Simpson DS, Shasha D, Mizrahi N, Olivier FAB, Speir M, Lawlor KE, Ben-Ami R, Traven A]. <i>Candida auris</i> uses metabolic strategies to escape and kill macrophages while avoiding robust activation of the NLRP3 inflammasome response. Cell Rep. 2023 May 30;42(5):112522.
*[https://pubmed.ncbi.nlm.nih.gov/38127686/ Horton MV, Holt AM, Nett JE]. Mechanisms of pathogenicity for the emerging fungus <i>Candida auris</i>. PLoS Pathog. 2023 Dec 21;19(12):e1011843. [Review]
VIRULENCE FACTORS
*[https://pubmed.ncbi.nlm.nih.gov/35142597/ Allert S, Schulz D, Kämmer P, Großmann P, Wolf T, Schäuble S, Panagiotou G, Brunke S, Hube B]. From environmental adaptation to host survival: Attributes that mediate pathogenicity of <i>Candida auris</i>. Virulence. 2022 Dec;13(1):191-214.
*[https://pubmed.ncbi.nlm.nih.gov/38992278/ Li C, Wang J, Li H, Wang Y, Wu H, Wei W, Wu D, Shao J, Wang T, Wang C]. Suppressing the virulence factors of <i>Candida auris</i> with baicalein through multifaceted mechanisms. Arch Microbiol. 2024 Jul 11;206(8):349.
*[https://pubmed.ncbi.nlm.nih.gov/33091071/ Du H, Bing J, Hu T, Ennis CL, Nobile CJ, Huang G]. <i>Candida auris</i>: Epidemiology, biology, antifungal resistance, and virulence. PLoS Pathog. 2020 Oct 22;16(10):e1008921. [Review]
</div>
==<i>C. dubliniensis</i>==
==<i>C. dubliniensis</i>==
<div class="mw-collapsible mw-collapsed">
===Cell Biology===
CELL WALL
*[https://pubmed.ncbi.nlm.nih.gov/33910989/ Bemena LD, Min K, Konopka JB, Neiman AM]. A conserved machinery underlies the synthesis of a chitosan layer in the <i>Candida</i> chlamydospore cell wall. mSphere. 2021 Apr 28;6(2):e00080-21.
*[https://pubmed.ncbi.nlm.nih.gov/23482280/ Yazdanparast SA, Nezarati SS, Heshmati F, Hamzehlou S]. Comparison of cell wall proteins in putative <i>Candida albicans</i> & <i>Candida dubliniensis</i> by using modified staining method & SDS-PAGE. Med J Islam Repub Iran. 2012 May;26(2):45-9.
DRUG RESISTANCE MECHANISMS
*[https://pubmed.ncbi.nlm.nih.gov/11709317/ Wirsching S, Moran GP, Sullivan DJ, Coleman DC, Morschhäuser J]. MDR1-mediated drug resistance in <i>Candida dubliniensis</i>. Antimicrob Agents Chemother. 2001 Dec;45(12):3416-21.
*[https://pubmed.ncbi.nlm.nih.gov/21531874/ Chen YL, Brand A, Morrison EL, Silao FG, Bigol UG, Malbas FF Jr, Nett JE, Andes DR, Solis NV, Filler SG, Averette A, Heitman J]. Calcineurin controls drug tolerance, hyphal growth, and virulence in <i>Candida dubliniensis</i>. Eukaryot Cell. 2011 Jun;10(6):803-19.
*[https://pubmed.ncbi.nlm.nih.gov/24474018/ Linares CE, Giacomelli SR, Altenhofen D, Alves SH, Morsch VM, Schetinger MR]. Fluconazole and amphotericin-B resistance are associated with increased catalase and superoxide dismutase activity in <i>Candida albicans</i> and <i>Candida dubliniensis</i>. Rev Soc Bras Med Trop. 2013 Nov-Dec;46(6):752-8.
*[https://pubmed.ncbi.nlm.nih.gov/14734017/ Sullivan DJ, Moran GP, Pinjon E, Al-Mosaid A, Stokes C, Vaughan C, Coleman DC]. Comparison of the epidemiology, drug resistance mechanisms, and virulence of <i>Candida dubliniensis</i> and <i>Candida albicans</i>. FEMS Yeast Res. 2004 Jan;4(4-5):369-76. (Review)
*[https://pubmed.ncbi.nlm.nih.gov/20521937/ Coleman DC, Moran GP, McManus BA, Sullivan DJ]. Mechanisms of antifungal drug resistance in <i>Candida dubliniensis</i>. Future Microbiol. 2010 Jun;5(6):935-49. (Review)
===Transformation/Response===
BIOFILMS
*[https://pubmed.ncbi.nlm.nih.gov/11526156/ Ramage G, Vande Walle K, Wickes BL, López-Ribot JL]. Biofilm formation by <i>Candida dubliniensis</i>. J Clin Microbiol. 2001 Sep;39(9):3234-40.
*[https://pubmed.ncbi.nlm.nih.gov/26432632/ Pujol C, Daniels KJ, Soll D]. Comparison of switching and biofilm formation between MTL-homozygous strains of <i>Candida albicans</i> and <i>Candida dubliniensis</i>. Eukaryot Cell. 2015 Dec;14(12):1186-202.
*[https://pubmed.ncbi.nlm.nih.gov/25911234/ Polke M, Hube B, Jacobsen ID]. <i>Candida</i> survival strategies. Adv Appl Microbiol. 2015:91:139-235. (Review)
ADHESION
*[https://pubmed.ncbi.nlm.nih.gov/15482009/ Jabra-Rizk MA, Falkler WA Jr, Merz WG, Baqui AA, Kelley JI, Meiller TF]. Cell surface hydrophobicity-associated adherence of <i>Candida dubliniensis</i> to human buccal epithelial cells. Rev Iberoam Micol. 2001 Mar;18(1):17-22.
*[https://pubmed.ncbi.nlm.nih.gov/19626546/ Biasoli MS, Tosello ME, Luque AG, Magaró HM]. Adherence, colonization and dissemination of <i>Candida dubliniensis</i> and other <i>Candida</i> species. Med Mycol. 2010 Mar;48(2):291-7.
*[https://pubmed.ncbi.nlm.nih.gov/24625677/ Jordan RP, Williams DW, Moran GP, Coleman DC, Sullivan DJ]. Comparative adherence of <i>Candida albicans</i> and <i>Candida dubliniensis</i> to human buccal epithelial cells and extracellular matrix proteins. Med Mycol. 2014 Apr;52(3):254-63.
MATING LOCI
*[https://pubmed.ncbi.nlm.nih.gov/15302834/ Pujol C, Daniels KJ, Lockhart SR, Srikantha T, Radke JB, Geiger J, Soll DR]. The closely related species <i>Candida albicans</i> and <i>Candida dubliniensis</i> can mate. Eukaryot Cell. 2004 Aug;3(4):1015-27.
*[https://pubmed.ncbi.nlm.nih.gov/26432632/ Pujol C, Daniels KJ, Soll D]. Comparison of switching and biofilm formation between MTL-homozygous strains of <i>Candida albicans</i> and <i>Candida dubliniensis</i>. Eukaryot Cell. 2015 Dec;14(12):1186-202.
*[https://pubmed.ncbi.nlm.nih.gov/26714067/ Yue H, Hu J, Guan G, Tao L, Du H, Li H, Huang G]. Discovery of the gray phenotype and white-gray-opaque tristable phenotypic transitions in <i>Candida dubliniensis</i>. Virulence. 2016 Apr 2;7(3):230-42.
CHLAMYDOSPORE DEVELOPMENT
*[https://pubmed.ncbi.nlm.nih.gov/15659176/ Staib P, Morschhäuser J]. Differential expression of the <i>NRG1</i> repressor controls species-specific regulation of chlamydospore development in <i>Candida albicans</i> and <i>Candida dubliniensis</i>. Mol Microbiol. 2005 Jan;55(2):637-52.
*[https://pubmed.ncbi.nlm.nih.gov/23613980/ Palige K, Linde J, Martin R, Böttcher B, Citiulo F, Sullivan DJ, Weber J, Staib C, Rupp S, Hube B, Morschhäuser J, Staib P]. Global transcriptome sequencing identifies chlamydospore specific markers in <i>Candida albicans</i> and <i>Candida dubliniensis</i>. PLoS One. 2013 Apr 15;8(4):e61940.
*[https://pubmed.ncbi.nlm.nih.gov/17302741/ Staib P, Morschhäuser J]. Chlamydospore formation in <i>Candida albicans</i> and <i>Candida dubliniensis</i>--an enigmatic developmental programme. Mycoses. 2007 Jan;50(1):1-12. (Review)
FILAMENTATION
*[https://pubmed.ncbi.nlm.nih.gov/17251042/ Stokes C, Moran GP, Spiering MJ, Cole GT, Coleman DC, Sullivan DJ]. Lower filamentation rates of <i>Candida dubliniensis</i> contribute to its lower virulence in comparison with <i>Candida albicans</i>. Fungal Genet Biol. 2007 Sep;44(9):920-31.
*[https://pubmed.ncbi.nlm.nih.gov/21531874/ Chen YL, Brand A, Morrison EL, Silao FG, Bigol UG, Malbas FF Jr, Nett JE, Andes DR, Solis NV, Filler SG, Averette A, Heitman J]. Calcineurin controls drug tolerance, hyphal growth, and virulence in <i>Candida dubliniensis</i>. Eukaryot Cell. 2011 Jun;10(6):803-19.
*[https://pubmed.ncbi.nlm.nih.gov/21706283/ Moyes DL, Murciano C, Runglall M, Kohli A, Islam A, Naglik JR]. Activation of MAPK/c-Fos induced responses in oral epithelial cells is specific to <i>Candida albicans</i> and <i>Candida dubliniensis</i> hyphae. Med Microbiol Immunol. 2012 Feb;201(1):93-101.
STRESS RESPONSE
*[https://pubmed.ncbi.nlm.nih.gov/17710623/ Tosello ME, Biasoli MS, Luque AG, Magaró HM, Krapp AR]. Oxidative stress response involving induction of protective enzymes in <i>Candida dubliniensis</i>. Med Mycol. 2007 Sep;45(6):535-40.
*[https://pubmed.ncbi.nlm.nih.gov/19239621/ Enjalbert B, Moran GP, Vaughan C, Yeomans T, Maccallum DM, Quinn J, Coleman DC, Brown AJ, Sullivan DJ]. Genome-wide gene expression profiling and a forward genetic screen show that differential expression of the sodium ion transporter Ena21 contributes to the differential tolerance of <i>Candida albicans</i> and <i>Candida dubliniensis</i> to osmotic stress. Mol Microbiol. 2009 Apr;72(1):216-28.
===Virulence===
HOST-PATHOGEN INTERACTIONS
*[https://pubmed.ncbi.nlm.nih.gov/20492535/ Koga-Ito CY, Komiyama EY, Martins CA, Vasconcellos TC, Jorge AO, Carvalho YR, do Prado RF, Balducci I]. Experimental systemic virulence of oral <i>Candida dubliniensis</i> isolates in comparison with <i>Candida albicans</i>, <i>Candida tropicalis</i> and <i>Candida krusei</i>. Mycoses. 2011 Sep;54(5):e278-85.
*[https://pubmed.ncbi.nlm.nih.gov/16213674/ Sullivan DJ, Moran GP, Coleman DC]. <i>Candida dubliniensis</i>: ten years on. FEMS Microbiol Lett. 2005 Dec 1;253(1):9-17. (Review)
VIRULENCE FACTORS
*[https://pubmed.ncbi.nlm.nih.gov/9579058/ D Gilfillan G, Derek J S, Parkinson T, Coleman DC, Gow NAR]. <i>Candida dubliniensis</i>: Phylogeny and putative virulence factors. Microbiology (Reading). 1998 Apr;144 ( Pt 4):829-838.
*[https://pubmed.ncbi.nlm.nih.gov/17251042/ Stokes C, Moran GP, Spiering MJ, Cole GT, Coleman DC, Sullivan DJ]. Lower filamentation rates of <i>Candida dubliniensis</i> contribute to its lower virulence in comparison with <i>Candida albicans</i>. Fungal Genet Biol. 2007 Sep;44(9):920-31.
*[https://pubmed.ncbi.nlm.nih.gov/21531874/ Chen YL, Brand A, Morrison EL, Silao FG, Bigol UG, Malbas FF Jr, Nett JE, Andes DR, Solis NV, Filler SG, Averette A, Heitman J]. Calcineurin controls drug tolerance, hyphal growth, and virulence in <i>Candida dubliniensis</i>. Eukaryot Cell. 2011 Jun;10(6):803-19.
*[https://pubmed.ncbi.nlm.nih.gov/12146754/ Vilela MM, Kamei K, Sano A, Tanaka R, Uno J, Takahashi I, Ito J, Yarita K, Miyaji M]. Pathogenicity and virulence of <i>Candida dubliniensis</i>: comparison with <i>C. albicans</i>. Med Mycol. 2002 Jun;40(3):249-57.
*[https://pubmed.ncbi.nlm.nih.gov/39722735/ Gómez-Gaviria M, Baruch-Martínez DA, Mora-Montes HM]. Exploring the biology, virulence, and general aspects of <i>Candida dubliniensis</i>. Infect Drug Resist. 2024 Dec 21;17:5755-5773. (Review)
</div>
==<i>C. tropicalis</i>==
==<i>C. tropicalis</i>==
<div class="mw-collapsible mw-collapsed">
===Cell Biology===
CELL WALL
*[https://pubmed.ncbi.nlm.nih.gov/26438063/ Kozik A, Karkowska-Kuleta J, Zajac D, Bochenska O, Kedracka-Krok S, Jankowska U, Rapala-Kozik M]. Fibronectin-, vitronectin- and laminin-binding proteins at the cell walls of <i>Candida parapsilosis</i> and <i>Candida tropicalis</i> pathogenic yeasts. BMC Microbiol. 2015 Oct 5;15:197.
*[https://pubmed.ncbi.nlm.nih.gov/26636137/ Karkowska-Kuleta J, Zajac D, Bochenska O, Kozik A]. Surfaceome of pathogenic yeasts, <i>Candida parapsilosis</i> and <i>Candida tropicalis</i>, revealed with the use of cell surface shaving method and shotgun proteomic approach. Acta Biochim Pol. 2015;62(4):807-19.
*[https://pubmed.ncbi.nlm.nih.gov/29718196/ Hernández-Chávez MJ, Franco B, Clavijo-Giraldo DM, Hernández NV, Estrada-Mata E, Mora-Montes HM]. Role of protein phosphomannosylation in the <i>Candida tropicalis</i>-macrophage interaction. FEMS Yeast Res. 2018 Aug 1;18(5).
*[https://pubmed.ncbi.nlm.nih.gov/36745535/ Ke CL, Lew SQ, Hsieh Y, Chang SC, Lin CH]. Convergent and divergent roles of the glucose-responsive kinase <i>SNF4</i> in <i>Candida tropicalis</i>. Virulence. 2023 Dec;14(1):2175914.
*[https://pubmed.ncbi.nlm.nih.gov/40517912/ Souza CM, Paulo EA, Souza NAA, Santos MMD, Mantovani MS, Furlaneto-Maia L, Furlaneto MC]. Enhanced biofilm formation by <i>Candida tropicalis</i> morphotypes under host-mimicking conditions: Insights into cell wall modifications and gene expression. Microb Pathog. 2025 Jun 13:107807.
DRUG RESISTANCE MECHANISMS
*[https://pubmed.ncbi.nlm.nih.gov/23877676/ Forastiero A, Mesa-Arango AC, Alastruey-Izquierdo A, Alcazar-Fuoli L, Bernal-Martinez L, Pelaez T, Lopez JF, Grimalt JO, Gomez-Lopez A, Cuesta I, Zaragoza O, Mellado E]. <i>Candida tropicalis</i> antifungal cross-resistance is related to different azole target (Erg11p) modifications. Antimicrob Agents Chemother. 2013 Oct;57(10):4769-81.
*[https://pubmed.ncbi.nlm.nih.gov/30472420/ Fan X, Xiao M, Zhang D, Huang JJ, Wang H, Hou X, Zhang L, Kong F, Chen SC, Tong ZH, Xu YC]. Molecular mechanisms of azole resistance in <i>Candida tropicalis</i> isolates causing invasive candidiasis in China. Clin Microbiol Infect. 2019 Jul;25(7):885-891.
*[https://pubmed.ncbi.nlm.nih.gov/32339847/ Paul S, Singh S, Sharma D, Chakrabarti A, Rudramurthy SM, Ghosh AK]. Dynamics of in vitro development of azole resistance in <i>Candida tropicalis</i>. J Glob Antimicrob Resist. 2020 Sep;22:553-561.
*[https://pubmed.ncbi.nlm.nih.gov/38102133/ an X, Dai RC, Zhang S, Geng YY, Kang M, Guo DW, Mei YN, Pan YH, Sun ZY, Xu YC, Gong J, Xiao M]. Tandem gene duplications contributed to high-level azole resistance in a rapidly expanding <i>Candida tropicalis</i> population. Nat Commun. 2023 Dec 15;14(1):8369.
*[https://pubmed.ncbi.nlm.nih.gov/38767668/ Khamrai A, Paul S, Rudramurthy SM, Ghosh AK]. Carbon substrates promotes stress resistance and drug tolerance in clinical isolates of <i>Candida tropicalis</i>. Arch Microbiol. 2024 May 20;206(6):270.
*[https://pubmed.ncbi.nlm.nih.gov/20413622/ Kothavade RJ, Kura MM, Valand AG, Panthaki MH]. <i>Candida tropicalis</i>: its prevalence, pathogenicity and increasing resistance to fluconazole. J Med Microbiol. 2010 Aug;59(Pt 8):873-880. (Review)
===Transformation/Response===
BIOFILMS
*[https://pubmed.ncbi.nlm.nih.gov/16849719/ Al-Fattani MA, Douglas LJ]. Biofilm matrix of <i>Candida albicans</i> and <i>Candida tropicalis</i>: chemical composition and role in drug resistance. J Med Microbiol. 2006 Aug;55(Pt 8):999-1008.
*[https://pubmed.ncbi.nlm.nih.gov/24612417/ Jones SK Jr, Hirakawa MP, Bennett RJ]. Sexual biofilm formation in <i>Candida tropicalis</i> opaque cells. Mol Microbiol. 2014 Apr;92(2):383-98.
*[https://pubmed.ncbi.nlm.nih.gov/32562809/ Moralez AP, Perini HF, Paulo EA, Furlaneto-Maia L, Furlaneto MC]. Effect of phenotypic switching on biofilm traits in <i>Candida tropicalis</i>. Microb Pathog. 2020 Dec;149:104346.
*[https://pubmed.ncbi.nlm.nih.gov/33603717/ da Silva MA, Baronetti JL, Páez PL, Paraje MG]. Oxidative imbalance in <i>Candida tropicalis</i> biofilms and its relation with persister cells. Front Microbiol. 2021 Feb 2;11:598834.
*[https://pubmed.ncbi.nlm.nih.gov/36061861/ Atiencia-Carrera MB, Cabezas-Mera FS, Vizuete K, Debut A, Tejera E, Machado A]. Evaluation of the biofilm life cycle between <i>Candida albicans</i> and <i>Candida tropicalis</i>. Front Cell Infect Microbiol. 2022 Aug 18;12:953168.
*[https://pubmed.ncbi.nlm.nih.gov/40517912/ Souza CM, Paulo EA, Souza NAA, Santos MMD, Mantovani MS, Furlaneto-Maia L, Furlaneto MC]. Enhanced biofilm formation by <i>Candida tropicalis</i> morphotypes under host-mimicking conditions: Insights into cell wall modifications and gene expression. Microb Pathog. 2025 Jun 13:107807.
*[https://pubmed.ncbi.nlm.nih.gov/36809069/ de Souza CM, Dos Santos MM, Furlaneto-Maia L, Furlaneto MC]. Adhesion and biofilm formation by the opportunistic pathogen <i>Candida tropicalis</i>: what do we know? Can J Microbiol. 2023 Jun 1;69(6):207-218. (Review)
ADHESION
*[https://pubmed.ncbi.nlm.nih.gov/8408636/ Bendel CM, Hostetter MK]. Distinct mechanisms of epithelial adhesion for <i>Candida albicans</i> and <i>Candida tropicalis</i>. Identification of the participating ligands and development of inhibitory peptides. J Clin Invest. 1993 Oct;92(4):1840-9.
*[https://pubmed.ncbi.nlm.nih.gov/36809069/ de Souza CM, Dos Santos MM, Furlaneto-Maia L, Furlaneto MC]. Adhesion and biofilm formation by the opportunistic pathogen <i>Candida tropicalis</i>: what do we know? Can J Microbiol. 2023 Jun 1;69(6):207-218. (Review)
MATING AND MATING LOCI
*[https://pubmed.ncbi.nlm.nih.gov/22158989/ Porman AM, Alby K, Hirakawa MP, Bennett RJ]. Discovery of a phenotypic switch regulating sexual mating in the opportunistic fungal pathogen <i>Candida tropicalis</i>. Proc Natl Acad Sci U S A. 2011 Dec 27;108(52):21158-63.
*[https://pubmed.ncbi.nlm.nih.gov/22544905/ Xie J, Du H, Guan G, Tong Y, Kourkoumpetis TK, Zhang L, Bai FY, Huang G]. N-acetylglucosamine induces white-to-opaque switching and mating in <i>Candida tropicalis</i>, providing new insights into adaptation and fungal sexual evolution. Eukaryot Cell. 2012 Jun;11(6):773-82.
*[https://pubmed.ncbi.nlm.nih.gov/23555286/ Porman AM, Hirakawa MP, Jones SK, Wang N, Bennett RJ]. MTL-independent phenotypic switching in <i>Candida tropicalis</i> and a dual role for Wor1 in regulating switching and filamentation. Porman AM, Hirakawa MP, Jones SK, Wang N, Bennett RJ.PLoS Genet. 2013 Mar;9(3):e1003369.
*[https://pubmed.ncbi.nlm.nih.gov/24123269/ Seervai RN, Jones SK Jr, Hirakawa MP, Porman AM, Bennett RJ]. Parasexuality and ploidy change in <i>Candida tropicalis</i>. Eukaryot Cell. 2013 Dec;12(12):1629-40.
*[https://pubmed.ncbi.nlm.nih.gov/24612417/ Jones SK Jr, Hirakawa MP, Bennett RJ]. Sexual biofilm formation in <i>Candida tropicalis</i> opaque cells. Mol Microbiol. 2014 Apr;92(2):383-98.
*[med.ncbi.nlm.nih.gov/27246518/ Zhang Y, Tao L, Zhang Q, Guan G, Nobile CJ, Zheng Q, Ding X, Huang G]. The gray phenotype and tristable phenotypic transitions in the human fungal pathogen <i>Candida tropicalis</i>. Fungal Genet Biol. 2016 Aug;93:10-6.
*[https://pubmed.ncbi.nlm.nih.gov/29030879/ Zheng Q, Zhang Q, Bing J, Ding X, Huang G]. Environmental and genetic regulation of white-opaque switching in <i>Candida tropicalis</i>. Mol Microbiol. 2017 Dec;106(6):999-1017.
*[https://pubmed.ncbi.nlm.nih.gov/29734333/ Du H, Zheng Q, Bing J, Bennett RJ, Huang G]. A coupled process of same- and opposite-sex mating generates polyploidy and genetic diversity in <i>Candida tropicalis</i>. PLoS Genet. 2018 May 7;14(5):e1007377.
FILAMENTATION
*[https://pubmed.ncbi.nlm.nih.gov/23555286/ Porman AM, Hirakawa MP, Jones SK, Wang N, Bennett RJ]. MTL-independent phenotypic switching in <i>Candida tropicalis</i> and a dual role for Wor1 in regulating switching and filamentation. Porman AM, Hirakawa MP, Jones SK, Wang N, Bennett RJ.PLoS Genet. 2013 Mar;9(3):e1003369.
*[https://pubmed.ncbi.nlm.nih.gov/24442892/ Chen YL, Yu SJ, Huang HY, Chang YL, Lehman VN, Silao FG, Bigol UG, Bungay AA, Averette A, Heitman J]. Calcineurin controls hyphal growth, virulence, and drug tolerance of <i>Candida tropicalis</i>. Eukaryot Cell. 2014 Jul;13(7):844-54.
*[https://pubmed.ncbi.nlm.nih.gov/26466925/ Zhang Q, Tao L, Guan G, Yue H, Liang W, Cao C, Dai Y, Huang G]. Regulation of filamentation in the human fungal pathogen <i>Candida tropicalis</i>. Mol Microbiol. 2016 Feb;99(3):528-45.
*[https://pubmed.ncbi.nlm.nih.gov/27851809/ Wu Y, Li YH, Yu SB, Li WG, Liu XS, Zhao L, Lu JX]. A genome-wide transcriptional analysis of yeast-hyphal transition in <i>Candida tropicalis</i> by RNA-Seq. PLoS One. 2016 Nov 16;11(11):e0166645.
*[https://pubmed.ncbi.nlm.nih.gov/27664724/ Jiang C, Li Z, Zhang L, Tian Y, Dong D, Peng Y]. Significance of hyphae formation in virulence of <i>Candida tropicalis</i> and transcriptomic analysis of hyphal cells. Microbiol Res. 2016 Nov;192:65-72.
*[https://pubmed.ncbi.nlm.nih.gov/32562809/ Moralez AP, Perini HF, Paulo EA, Furlaneto-Maia L, Furlaneto MC]. Effect of phenotypic switching on biofilm traits in <i>Candida tropicalis</i>. Microb Pathog. 2020 Dec;149:104346.
*[https://pubmed.ncbi.nlm.nih.gov/40216406/ Perini HF, de Souza CM, Paulo EA, Tomiotto-Pellissier F, Pavanelli WR, Furlaneto-Maia L, Furlaneto MC]. Role of phenotypic switching in the adaptive response of <i>Candida tropicalis</i> to hyperosmotic stress. Med Mycol. 2025 Apr 2;63(4):myaf035.
STRESS RESPONSE
*[https://pubmed.ncbi.nlm.nih.gov/25384372/ Ilyas S, Rehman A]. Oxidative stress, glutathione level and antioxidant response to heavy metals in multi-resistant pathogen, <i>Candida tropicalis</i>. Environ Monit Assess. 2015 Jan;187(1):4115.
*[https://pubmed.ncbi.nlm.nih.gov/28920150/ Khan Z, Rehman A, Nisar MA, Zafar S, Hussain SZ, Zerr I, Hussain I, Waseem M, Arif M]. Molecular basis of Cd+2 stress response in <i>Candida tropicalis</i>. Appl Microbiol Biotechnol. 2017 Oct;101(20):7715-7728.
*[https://pubmed.ncbi.nlm.nih.gov/38767668/ Khamrai A, Paul S, Rudramurthy SM, Ghosh AK]. Carbon substrates promotes stress resistance and drug tolerance in clinical isolates of <i>Candida tropicalis</i>. Arch Microbiol. 2024 May 20;206(6):270.
*[https://pubmed.ncbi.nlm.nih.gov/40216406/ Perini HF, de Souza CM, Paulo EA, Tomiotto-Pellissier F, Pavanelli WR, Furlaneto-Maia L, Furlaneto MC]. Role of phenotypic switching in the adaptive response of <i>Candida tropicalis</i> to hyperosmotic stress. Med Mycol. 2025 Apr 2;63(4):myaf035.
===Virulence===
HOST-PATHOGEN INTERACTIONS
*[https://pubmed.ncbi.nlm.nih.gov/29718196/ Hernández-Chávez MJ, Franco B, Clavijo-Giraldo DM, Hernández NV, Estrada-Mata E, Mora-Montes HM]. Role of protein phosphomannosylation in the <i>Candida tropicalis</i>-macrophage interaction. FEMS Yeast Res. 2018 Aug 1;18(5).
*[https://pubmed.ncbi.nlm.nih.gov/31467372/ Perini HF, Moralez ATP, Almeida RSC, Panagio LA, Junior AOG, Barcellos FG, Furlaneto-Maia L, Furlaneto MC]. Phenotypic switching in <i>Candida tropicalis</i> alters host-pathogen interactions in a <i>Galleria mellonella</i> infection model. Sci Rep. 2019 Aug 29;9(1):12555.
*[https://pubmed.ncbi.nlm.nih.gov/31849889/ Hernández-Chávez MJ, Clavijo-Giraldo DM, Novák Á, Lozoya-Pérez NE, Martínez-Álvarez JA, Salinas-Marín R, Hernández NV, Martínez-Duncker I, Gácser A, Mora-Montes HM]. Role of protein mannosylation in the <i>Candida tropicalis</i>-host interaction. Front Microbiol. 2019 Nov 28;10:2743.
*[https://pubmed.ncbi.nlm.nih.gov/39057387/ Hernández-Chávez MJ, Martínez-Duncker I, Clavijo-Giraldo DM, López-Ramirez LA, Mora-Montes HM]. <i>Candida tropicalis PMT2</i> is a dispensable gene for viability but required for proper interaction with the host. J Fungi (Basel). 2024 Jul 20;10(7):502.
VIRULENCE FACTORS
*[https://pubmed.ncbi.nlm.nih.gov/24442892/ Chen YL, Yu SJ, Huang HY, Chang YL, Lehman VN, Silao FG, Bigol UG, Bungay AA, Averette A, Heitman J]. Calcineurin controls hyphal growth, virulence, and drug tolerance of <i>Candida tropicalis</i>. Eukaryot Cell. 2014 Jul;13(7):844-54.
*[https://pubmed.ncbi.nlm.nih.gov/27664724/ Jiang C, Li Z, Zhang L, Tian Y, Dong D, Peng Y]. Significance of hyphae formation in virulence of <i>Candida tropicalis</i> and transcriptomic analysis of hyphal cells. Microbiol Res. 2016 Nov;192:65-72.
*[https://pubmed.ncbi.nlm.nih.gov/36745535/ Ke CL, Lew SQ, Hsieh Y, Chang SC, Lin CH]. Convergent and divergent roles of the glucose-responsive kinase <i>SNF4</i> in <i>Candida tropicalis</i>. Virulence. 2023 Dec;14(1):2175914.
*[https://pubmed.ncbi.nlm.nih.gov/22037823/ Negri M, Silva S, Henriques M, Oliveira R]. Insights into <i>Candida tropicalis</i> nosocomial infections and virulence factors. Eur J Clin Microbiol Infect Dis. 2012 Jul;31(7):1399-412.
*[https://pubmed.ncbi.nlm.nih.gov/31544690/ Staniszewska M]. Virulence factors in <i>Candida</i> species. Curr Protein Pept Sci. 2020;21(3):313-323. (Review)
*[https://pubmed.ncbi.nlm.nih.gov/37505455/ Dos Santos MM, Ishida K]. We need to talk about <i>Candida tropicalis</i>: Virulence factors and survival mechanisms. Med Mycol. 2023 Aug 2;61(8):myad075. (Review)
</div>


=Current Taxonomy=
=Current Taxonomy=
 
<div class="mw-collapsible mw-collapsed">
The genus <i>Candida</i> was originally formed as a heterogeneous grouping of opportunistic pathogenic budding yeasts that lacked sexual reproduction ([https://pubmed.ncbi.nlm.nih.gov/38895705/ Groenewald et al., 2023]). Further genomic study has revealed evolutionary distances between these species that argues for taxonomic revision within the budding yeast subphylum Saccharomycotina ([https://pubmed.ncbi.nlm.nih.gov/33148650/ Shen et al., 2020], [https://pubmed.ncbi.nlm.nih.gov/39161632/ Liu et al., 2024], [https://pubmed.ncbi.nlm.nih.gov/36632423/ Kidd et al., 2023]). Interestingly, it appears pathogenicity within humans has evolved multiple times in this subphylum ([https://pubmed.ncbi.nlm.nih.gov/35508719/ Rokas, 2022])
The genus <i>Candida</i> was originally formed as a heterogeneous grouping of opportunistic pathogenic budding yeasts that lacked sexual reproduction ([https://pubmed.ncbi.nlm.nih.gov/38895705/ Groenewald et al., 2023]). Further genomic study has revealed evolutionary distances between these species that argues for taxonomic revision within the budding yeast subphylum Saccharomycotina ([https://pubmed.ncbi.nlm.nih.gov/33148650/ Shen et al., 2020], [https://pubmed.ncbi.nlm.nih.gov/39161632/ Liu et al., 2024], [https://pubmed.ncbi.nlm.nih.gov/36632423/ Kidd et al., 2023]). Interestingly, it appears pathogenicity within humans has evolved multiple times in this subphylum ([https://pubmed.ncbi.nlm.nih.gov/35508719/ Rokas, 2022])


Line 293: Line 525:
*<i>Nakaseomyces glabratus</i> (syn. <i>Candida glabrata</i> )
*<i>Nakaseomyces glabratus</i> (syn. <i>Candida glabrata</i> )
*<i>Candidozyma auris</i>  (syn. <i>Candida auris</i> )
*<i>Candidozyma auris</i>  (syn. <i>Candida auris</i> )
</div>


= Strain Information =
= Strain Information =
Line 298: Line 531:


==<i>Candida albicans</i> Strains==
==<i>Candida albicans</i> Strains==
<div class="mw-collapsible mw-collapsed">


===SC5314===
===SC5314===
Line 427: Line 661:


<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/11371541/ Strauss et al. 2001]. J Bacteriol. 2001 Jun;183(12):3761-9.
<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/11371541/ Strauss et al. 2001]. J Bacteriol. 2001 Jun;183(12):3761-9.
</div>


==<i>Candida glabrata</i> (<i>Nakaseomyces glabratus</i>) Strains==
==<i>Candida glabrata</i> (<i>Nakaseomyces glabratus</i>) Strains==
 
<div class="mw-collapsible mw-collapsed">
===B===
===B===
<B>Genotype:</B> Wild type
<B>Genotype:</B> Wild type
Line 494: Line 729:


<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/16569856/ Tsai et al., 2006]. Antimicrob Agents Chemother. 2006 Apr;50(4):1384-92.
<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/16569856/ Tsai et al., 2006]. Antimicrob Agents Chemother. 2006 Apr;50(4):1384-92.
 
</div>
==<i>Candida parapsilosis</i> Strains==
==<i>Candida parapsilosis</i> Strains==
<div class="mw-collapsible mw-collapsed">


===ATCC 22019===
===ATCC 22019===
Line 544: Line 780:
[https://pubmed.ncbi.nlm.nih.gov/15449175/  Nosek et al., 2004]. Mol Genet Genomics 272(2):173-80;
[https://pubmed.ncbi.nlm.nih.gov/15449175/  Nosek et al., 2004]. Mol Genet Genomics 272(2):173-80;
[https://pubmed.ncbi.nlm.nih.gov/39083682/ Mutalová et al., 2024]. Microbiol Resour Announc. 2024 Jul 31;13(9):e00347-24.
[https://pubmed.ncbi.nlm.nih.gov/39083682/ Mutalová et al., 2024]. Microbiol Resour Announc. 2024 Jul 31;13(9):e00347-24.
 
</div>
==<i>Candida auris</i> (<i>Candidozyma auris</i>) Strains==
==<i>Candida auris</i> (<i>Candidozyma auris</i>) Strains==
 
<div class="mw-collapsible mw-collapsed">
===AR0382 (B11109)===
===AR0382 (B11109)===
<B>Genotype:</B> Wild type
<B>Genotype:</B> Wild type
Line 590: Line 826:


<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/38722168/ Yang et al., 2024]. Infect Immun. 2024 Jun 11;92(6):e0010324.
<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/38722168/ Yang et al., 2024]. Infect Immun. 2024 Jun 11;92(6):e0010324.
 
</div>
==<i>Candida tropicalis</i> Strains==
==<i>Candida tropicalis</i> Strains==
 
<div class="mw-collapsible mw-collapsed">
===ATCC 20336 (pK233)===
===ATCC 20336 (pK233)===
<B>Genotype:</B> Wild type
<B>Genotype:</B> Wild type
Line 627: Line 863:


<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/15849785/ He and Chen, 2005]. Yeast 22(6):481-91.
<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/15849785/ He and Chen, 2005]. Yeast 22(6):481-91.
 
</div>
==<i>Candida dubliniensis</i> Strains==
==<i>Candida dubliniensis</i> Strains==
<div class="mw-collapsible mw-collapsed">
===CD36===
===CD36===
<B>Genotype:</B> Wild type
<B>Genotype:</B> Wild type
Line 635: Line 872:


<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/7551019/ Sullivan et al., 1995]. Microbiology (Reading) 1995 Jul:141 ( Pt 7):1507-21.
<B>References:</B> [https://pubmed.ncbi.nlm.nih.gov/7551019/ Sullivan et al., 1995]. Microbiology (Reading) 1995 Jul:141 ( Pt 7):1507-21.
</div>


=Protocols and Methods=
=Protocols and Methods=
==<i>Candida</i> Identification==
<div class="mw-collapsible mw-collapsed">
===Universal primers===
*used to amplify ITS genes for subsequent sequencing to identify species
**Fungi_ITS_Seq_F: GTGAATCATCGAATCTTTGAA
**Fungi_ITS_Seq_R: TCCTCCGCTTATTGATATGC
**These are primers ITS86F and ITS4 from the reference [https://microbiomejournal.biomedcentral.com/articles/10.1186/s40168-019-0748-9 Park et al.]
**The primers themselves are from older literature, but this combination seems to work best for yeast species
</div>
==<i>Candida albicans</i> Protocols and Methods==
==<i>Candida albicans</i> Protocols and Methods==
 
<div class="mw-collapsible mw-collapsed">
* Basic techniques
* Basic techniques
**[https://link.springer.com/book/10.1007/978-1-60327-151-6 <i>Candida albicans</i>: Methods and Protocols]
**[https://link.springer.com/book/10.1007/978-1-60327-151-6 <i>Candida albicans</i>: Methods and Protocols]
Line 663: Line 911:
** [https://pubmed.ncbi.nlm.nih.gov/23211681/ Junqueira, 2012]. Virulence. 2012 Oct 1;3(6):474-6
** [https://pubmed.ncbi.nlm.nih.gov/23211681/ Junqueira, 2012]. Virulence. 2012 Oct 1;3(6):474-6
** [https://pubmed.ncbi.nlm.nih.gov/32970818/ Wojda et al., 2020]. Pathog Dis. 2020 Nov 23;78(9):ftaa057
** [https://pubmed.ncbi.nlm.nih.gov/32970818/ Wojda et al., 2020]. Pathog Dis. 2020 Nov 23;78(9):ftaa057
 
</div>
==<i>Candida glabrata</i> (<i>Nakaseomyces glabratus</i>) Protocols and Methods==
==<i>Candida glabrata</i> (<i>Nakaseomyces glabratus</i>) Protocols and Methods==
 
<div class="mw-collapsible mw-collapsed">
* Basic techniques
* Basic techniques
**[https://link.springer.com/book/10.1007/978-1-0716-2549-1 <i>Candida</i> Species: Methods and Protocols]
**[https://link.springer.com/book/10.1007/978-1-0716-2549-1 <i>Candida</i> Species: Methods and Protocols]
Line 689: Line 937:
** [https://pubmed.ncbi.nlm.nih.gov/23211681/ Junqueira, 2012]. Virulence. 2012 Oct 1;3(6):474-6
** [https://pubmed.ncbi.nlm.nih.gov/23211681/ Junqueira, 2012]. Virulence. 2012 Oct 1;3(6):474-6
** [https://pubmed.ncbi.nlm.nih.gov/32970818/ Wojda et al., 2020]. Pathog Dis. 2020 Nov 23;78(9):ftaa057
** [https://pubmed.ncbi.nlm.nih.gov/32970818/ Wojda et al., 2020]. Pathog Dis. 2020 Nov 23;78(9):ftaa057
 
</div>
==<i>Candida parapsilosis</i> Protocols and Methods==
==<i>Candida parapsilosis</i> Protocols and Methods==
 
<div class="mw-collapsible mw-collapsed">
* Basic techniques
* Basic techniques
** [https://link.springer.com/book/10.1007/978-1-0716-2549-1 <i>Candida</i> Species: Methods and Protocols]  
** [https://link.springer.com/book/10.1007/978-1-0716-2549-1 <i>Candida</i> Species: Methods and Protocols]  
Line 712: Line 960:
** [https://pubmed.ncbi.nlm.nih.gov/36416551/ Lombardi et al.,2022]. mSphere. 2022 Dec 21;7(6):e0039322
** [https://pubmed.ncbi.nlm.nih.gov/36416551/ Lombardi et al.,2022]. mSphere. 2022 Dec 21;7(6):e0039322
** [https://pubmed.ncbi.nlm.nih.gov/36008654/ Lombardi and Butler,2022]. Methods Mol Biol. 2022:2542:13-40
** [https://pubmed.ncbi.nlm.nih.gov/36008654/ Lombardi and Butler,2022]. Methods Mol Biol. 2022:2542:13-40
 
</div>
==<i>Candida auris</i> (<i>Candidozyma auris</i>) Protocols and Methods==
==<i>Candida auris</i> (<i>Candidozyma auris</i>) Protocols and Methods==
 
<div class="mw-collapsible mw-collapsed">
* Basic techniques
* Basic techniques
** [https://link.springer.com/book/10.1007/978-1-0716-2417-3 Candida auris: Methods and Protocols]
** [https://link.springer.com/book/10.1007/978-1-0716-2417-3 Candida auris: Methods and Protocols]
Line 754: Line 1,002:
** [https://pubmed.ncbi.nlm.nih.gov/29315379/ Chupácová et al., 2018]. Pathog Dis. 2018 Feb 1;76(1)
** [https://pubmed.ncbi.nlm.nih.gov/29315379/ Chupácová et al., 2018]. Pathog Dis. 2018 Feb 1;76(1)
** [https://pubmed.ncbi.nlm.nih.gov/30386966/ Dekkerová-Chupáčová et al., 2018]. Mycopathologia. 2018 Dec;183(6)
** [https://pubmed.ncbi.nlm.nih.gov/30386966/ Dekkerová-Chupáčová et al., 2018]. Mycopathologia. 2018 Dec;183(6)
 
</div>
==<i>Candida tropicalis</i> Protocols and Methods==
==<i>Candida tropicalis</i> Protocols and Methods==
 
<div class="mw-collapsible mw-collapsed">
* Basic techniques
* Basic techniques
** [https://link.springer.com/book/10.1007/978-1-0716-2549-1 <i>Candida</i> Species: Methods and Protocols]  
** [https://link.springer.com/book/10.1007/978-1-0716-2549-1 <i>Candida</i> Species: Methods and Protocols]  
Line 776: Line 1,024:
** [https://pubmed.ncbi.nlm.nih.gov/23877676/ Forastiero et al., 2013]. Antimicrob Agents Chemother. 2013 Oct;57(10):4769-81
** [https://pubmed.ncbi.nlm.nih.gov/23877676/ Forastiero et al., 2013]. Antimicrob Agents Chemother. 2013 Oct;57(10):4769-81
** [https://pubmed.ncbi.nlm.nih.gov/32867152/ García-Carnero et al., 2020]. J Fungi (Basel). 2020 Aug 27;6(3):152
** [https://pubmed.ncbi.nlm.nih.gov/32867152/ García-Carnero et al., 2020]. J Fungi (Basel). 2020 Aug 27;6(3):152
</div>


=Species Comparisons by Topic=
=Species Comparisons by Topic=


==Ploidy==
==Ploidy==
 
<div class="mw-collapsible mw-collapsed">
<B>Notes:</B> <i>Candida albicans</i> and its close relatives are all on a single phylogenetic branch characterized by diploidy, while the two typical haploid species (<i>C. glabrata</i> and <i>C. auris</i>) are on distinct, distantly related branches for which haploidy is the standard form. Note that the two haploid pathogens are more prone to pleiotropic resistance because only a single mutation is needed in the haploid genome to generate stable change.
<B>Notes:</B> <i>Candida albicans</i> and its close relatives are all on a single phylogenetic branch characterized by diploidy, while the two typical haploid species (<i>C. glabrata</i> and <i>C. auris</i>) are on distinct, distantly related branches for which haploidy is the standard form. Note that the two haploid pathogens are more prone to pleiotropic resistance because only a single mutation is needed in the haploid genome to generate stable change.


Line 800: Line 1,049:


From [https://www.nature.com/articles/s41467-018-07779-6/figures/3 Munoz et al., 2018]
From [https://www.nature.com/articles/s41467-018-07779-6/figures/3 Munoz et al., 2018]
 
</div>


==CUG codon usage==
==CUG codon usage==
 
<div class="mw-collapsible mw-collapsed">
<B>Notes:</B> Yeasts of the <i>Candida</i> clade (as opposed to <i>C. glabrata</i>, also known as <i>Nakaseomyces glabratus</i>, which is on the <i>Saccharomyces</i> clade) have undergone an evolutionary reassignment of the CUG codon from leucine to serine. This is due to a novel serine-tRNA (ser-tRNACAG) that contains a guanosine at position 33, a position that is occupied by a pyrimidine (uridine) in nearly all other tRNAs.
<B>Notes:</B> Yeasts of the <i>Candida</i> clade (as opposed to <i>C. glabrata</i>, also known as <i>Nakaseomyces glabratus</i>, which is on the <i>Saccharomyces</i> clade) have undergone an evolutionary reassignment of the CUG codon from leucine to serine. This is due to a novel serine-tRNA (ser-tRNACAG) that contains a guanosine at position 33, a position that is occupied by a pyrimidine (uridine) in nearly all other tRNAs.


Line 810: Line 1,059:
*[https://pubmed.ncbi.nlm.nih.gov/7784200/ Santos and Tuite, 1995]
*[https://pubmed.ncbi.nlm.nih.gov/7784200/ Santos and Tuite, 1995]
*[https://pubmed.ncbi.nlm.nih.gov/8890179/ Santos et al., 1996]
*[https://pubmed.ncbi.nlm.nih.gov/8890179/ Santos et al., 1996]
*[https://pmc.ncbi.nlm.nih.gov/articles/PMC12471149/ Čermáková and Heidingsfeld, 2025]


===Reassigned CUG as serine===
===Reassigned CUG as serine===
Line 825: Line 1,075:


From [https://pubmed.ncbi.nlm.nih.gov/19465905/ Butler et al., 2009]
From [https://pubmed.ncbi.nlm.nih.gov/19465905/ Butler et al., 2009]
 
</div>
==Mitochondrial genome==
==Mitochondrial genome==
 
<div class="mw-collapsible mw-collapsed">
<B>Notes:</B> <i>Candida parapsilosis</i> is unusual in having a mitochondrial genome that is linear and capped by telomeric ends. The close relatives of this species, <i>C. orthopsilosis</i> and <i>C. metapsilosis</i> and <i>Candida subhashii</i>, have a mix of circular and linear mitochondrial genomes. The other <i>Candida</i> spp. are exclusively circular.
<B>Notes:</B> <i>Candida parapsilosis</i> is unusual in having a mitochondrial genome that is linear and capped by telomeric ends. The close relatives of this species, <i>C. orthopsilosis</i> and <i>C. metapsilosis</i> and <i>Candida subhashii</i>, have a mix of circular and linear mitochondrial genomes. The other <i>Candida</i> spp. are exclusively circular.


Line 853: Line 1,103:


From [https://pubmed.ncbi.nlm.nih.gov/16684995/ Kosa et al., 2006]
From [https://pubmed.ncbi.nlm.nih.gov/16684995/ Kosa et al., 2006]
 
</div>
==Filamentous growth==
==Filamentous growth==
 
<div class="mw-collapsible mw-collapsed">
 
<B>Notes:</B> <i>Candida spp.</i> vary in filamentous growth as a means of infection/invasion. <i>C. albicans</i> and its close relative <i>C. dubliniensis</i> use true hyphae to penetrate tissues, while <i>C. parapsilosis</i> and <i>C. tropicalis</i> can penetrate tissues by means of pseudohyphae (lacking septa). In contrast, <i>C. glabrata</i> almost never forms filaments and infects in the yeast form. <i>C. auris </i> is an outlier in that it infects both by pseudohyphae and in the yeast form.
<B>Notes:</B> <i>Candida spp.</i> vary in filamentous growth as a means of infection/invasion. <i>C. albicans</i> and its close relative <i>C. dubliniensis</i> use true hyphae to penetrate tissues, while <i>C. parapsilosis</i> and <i>C. tropicalis</i> can penetrate tissues by means of pseudohyphae (lacking septa). In contrast, <i>C. glabrata</i> almost never forms filaments and infects in the yeast form. <i>C. auris </i> is an outlier in that it infects both by pseudohyphae and in the yeast form.


Line 881: Line 1,130:
*<i>C. glabrata</i>
*<i>C. glabrata</i>
*<i>C. auris</i>
*<i>C. auris</i>
 
</div>
==Biofilms==
==Biofilms==
 
<div class="mw-collapsible mw-collapsed">
<B>Notes:</B> <i>Candida</i> species all form biofilms but not in the same manner. Biofilms all begin as adherence to a surface and then excretion of an extracellular matrix composed mainly of proteins, carbohydrates, and lipids. All species employ extracellular vesicles to facilitate excretion. They differ in the types of cells that inhabit the biofilm environment.
<B>Notes:</B> <i>Candida</i> species all form biofilms but not in the same manner. Biofilms all begin as adherence to a surface and then excretion of an extracellular matrix composed mainly of proteins, carbohydrates, and lipids. All species employ extracellular vesicles to facilitate excretion. They differ in the types of cells that inhabit the biofilm environment.


Line 906: Line 1,155:
===Biofilms comprising primarily yeast cells===
===Biofilms comprising primarily yeast cells===
*<i>C. glabrata</i>
*<i>C. glabrata</i>
 
</div>
==Pathogenicity==
==Pathogenicity==
 
<div class="mw-collapsible mw-collapsed">
<B>Notes:</B> <i>Candida</i> species show heterogeneity in pathogenicity, where each species has a unique profile. See descriptions below.
<B>Notes:</B> <i>Candida</i> species show heterogeneity in pathogenicity, where each species has a unique profile. See descriptions below.


Line 942: Line 1,191:
===<i>C. dubliniensis</i>===
===<i>C. dubliniensis</i>===
*As a close relative of <i>C. albicans</i>, <i>C. dubliniensis</i> is a successful colonizer of the human host. However, it primarily lives as a benign commensal and only rarely causes invasive infection
*As a close relative of <i>C. albicans</i>, <i>C. dubliniensis</i> is a successful colonizer of the human host. However, it primarily lives as a benign commensal and only rarely causes invasive infection
*When <i>C. dubliniensis</i> does cause infection, it most commonly causes oral candidiasis (see [https://pubmed.ncbi.nlm.nih.gov/21706283/ Moyes et al.] and [https://pubmed.ncbi.nlm.nih.gov/21531874/ Chen et al.])


===<i>C. auris</i>===
===<i>C. auris</i>===
Line 949: Line 1,199:
*As <i>C. auris</i> preferentially colonizes the cooler skin rather than the hotter gut microbiome, new commensalism may be consistent with a recent acquisition of thermotolerance
*As <i>C. auris</i> preferentially colonizes the cooler skin rather than the hotter gut microbiome, new commensalism may be consistent with a recent acquisition of thermotolerance
*The inclination to colonize skin has made <i>C. auris</i> particularly problematic in hospital settings, where widespread outbreaks have become common
*The inclination to colonize skin has made <i>C. auris</i> particularly problematic in hospital settings, where widespread outbreaks have become common
 
</div>
==Mating/Reproduction==
==Mating/Reproduction==
 
<div class="mw-collapsible mw-collapsed">
<B>Notes:</B> <i>Candida</i> species show heterogeneity in mating/reproduction, as described below. References are by species.
<B>Notes:</B> <i>Candida</i> species show heterogeneity in mating/reproduction, as described below. References are by species.


Line 1,012: Line 1,262:


[https://pubmed.ncbi.nlm.nih.gov/30559369/ Muñoz et al., 2018]
[https://pubmed.ncbi.nlm.nih.gov/30559369/ Muñoz et al., 2018]
 
</div>
==Drug resistance==
==Drug resistance==
 
<div class="mw-collapsible mw-collapsed">
<B>Notes:</B> <i>Candida</i> species show distinct drug resistance profiles. While all species can acquire resistance, inherent resistance and/or tolerance is especially concerning for <i>C. auris</i> and <i>C. glabrata</i>, likely due to their haploid genomes.
<B>Notes:</B> <i>Candida</i> species show distinct drug resistance profiles. While all species can acquire resistance, inherent resistance and/or tolerance is especially concerning for <i>C. auris</i> and <i>C. glabrata</i>, likely due to their haploid genomes.


Line 1,042: Line 1,292:
===Resistance within biofilms===
===Resistance within biofilms===
*All species
*All species
 
</div>
==Respiratory metabolism==
==Respiratory metabolism==
 
<div class="mw-collapsible mw-collapsed">
<B>Notes:</B> The Crabtree effect explains why baker’s yeast is also called brewer’s yeast, in that <i>S. cerevisiae</i> preferentially converts sugar to alcohol in lieu of other types of respiration. This is referred to as Crabtree positive. Among the pathogenic yeasts, the only member with this ability is the phylogenetic outlier <i>C. glabrata</i>, which is more closely related to <i>S. cerevisiae</i> than to the other pathogenic yeasts. The other pathogenic yeasts are all Crabtree negative, meaning they do not produce alcohol as a product of respiration. For these non-fermentative yeasts, the ability to utilize many carbon sources (with little preference for glucose) is thought to provide an advantage for pathogenesis in various host niches.
<B>Notes:</B> The Crabtree effect explains why baker’s yeast is also called brewer’s yeast, in that <i>S. cerevisiae</i> preferentially converts sugar to alcohol in lieu of other types of respiration. This is referred to as Crabtree positive. Among the pathogenic yeasts, the only member with this ability is the phylogenetic outlier <i>C. glabrata</i>, which is more closely related to <i>S. cerevisiae</i> than to the other pathogenic yeasts. The other pathogenic yeasts are all Crabtree negative, meaning they do not produce alcohol as a product of respiration. For these non-fermentative yeasts, the ability to utilize many carbon sources (with little preference for glucose) is thought to provide an advantage for pathogenesis in various host niches.


Line 1,062: Line 1,312:
===Crabtree positive (fermentative)===
===Crabtree positive (fermentative)===
*<i>C. glabrata</i>
*<i>C. glabrata</i>
</div>
==Virulence Factors==
<div class="mw-collapsible mw-collapsed">
<B>Notes:</B> Pathogenic yeasts vary in use of secreted and membrane-bound virulence factors involved in invasion, damage and translocation.
<B>References</B>
*[https://pubmed.ncbi.nlm.nih.gov/31544690/ Staniszewska, 2020]
*[https://pubmed.ncbi.nlm.nih.gov/34506621/ Lim et al., 2021]
[[File:Virulence factors.png|frame|center]]
From [https://pubmed.ncbi.nlm.nih.gov/34506621/ Lim et al., 2021]
</div>


=Datasets Available in CGD=
=Datasets Available in CGD=
Line 1,068: Line 1,331:


==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_albicans_SC5314&loc=Ca22chr1A_C_albicans_SC5314%3A120520..134789&tracks=DNA%2CTranscribed%20Features%2Csegal_hapA_transposon_hits%2Csegal_hapA_transposon_reads%2ChapA_alb_dub_phyloP_scores%2ChapA_CanLod_phyloP_scores%2ChapA_CTG_phyloP_scores%2ChapA_Sacc_phyloP_scores%2Cbruno_nOxi_hapA_coverage&highlight= <i>C. albicans</i> in JBrowse]==
==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_albicans_SC5314&loc=Ca22chr1A_C_albicans_SC5314%3A120520..134789&tracks=DNA%2CTranscribed%20Features%2Csegal_hapA_transposon_hits%2Csegal_hapA_transposon_reads%2ChapA_alb_dub_phyloP_scores%2ChapA_CanLod_phyloP_scores%2ChapA_CTG_phyloP_scores%2ChapA_Sacc_phyloP_scores%2Cbruno_nOxi_hapA_coverage&highlight= <i>C. albicans</i> in JBrowse]==
 
<div class="mw-collapsible mw-collapsed">
*[https://pubmed.ncbi.nlm.nih.gov/20810668/ Bruno et al., 2010]. Comprehensive annotation of the transcriptome of the human fungal pathogen <i>Candida albicans</i> using RNA-seq. Genome Res. 2010 Oct;20(10):1451-8.
*[https://pubmed.ncbi.nlm.nih.gov/20810668/ Bruno et al., 2010]. Comprehensive annotation of the transcriptome of the human fungal pathogen <i>Candida albicans</i> using RNA-seq. Genome Res. 2010 Oct;20(10):1451-8.
*[https://pubmed.ncbi.nlm.nih.gov/19465905/ Butler et al., 2009]. Evolution of pathogenicity and sexual reproduction in eight <i>Candida</i> genomes. Nature. 2009 Jun 4;459(7247):657-62.
*[https://pubmed.ncbi.nlm.nih.gov/19465905/ Butler et al., 2009]. Evolution of pathogenicity and sexual reproduction in eight <i>Candida</i> genomes. Nature. 2009 Jun 4;459(7247):657-62.
Line 1,081: Line 1,344:
*[https://pubmed.ncbi.nlm.nih.gov/38905306/ Rai, et al., 2024]. Metabolic reprogramming during <i>Candida albicans</i> planktonic-biofilm transition is modulated by the transcription factors <i>Zcf15</i> and <i>Zcf26</i>. PLoS Biol. 2024 Jun 21;22(6):e3002693.
*[https://pubmed.ncbi.nlm.nih.gov/38905306/ Rai, et al., 2024]. Metabolic reprogramming during <i>Candida albicans</i> planktonic-biofilm transition is modulated by the transcription factors <i>Zcf15</i> and <i>Zcf26</i>. PLoS Biol. 2024 Jun 21;22(6):e3002693.
*[https://pubmed.ncbi.nlm.nih.gov/38921373/ Zhang, et al. 2024]. DNA damage checkpoints govern global gene transcription and exhibit species-specific regulation on <i>HOF1</i> in <i>Candida albicans</i>. J Fungi (Basel). 2024 May 29;10(6):387.
*[https://pubmed.ncbi.nlm.nih.gov/38921373/ Zhang, et al. 2024]. DNA damage checkpoints govern global gene transcription and exhibit species-specific regulation on <i>HOF1</i> in <i>Candida albicans</i>. J Fungi (Basel). 2024 May 29;10(6):387.
 
</div>
==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_parapsilosis_CDC317&loc=Contig005569_C_parapsilosis_CDC317%3A2164961..2179340&tracks=DNA%2CTranscribed%20Features%2Cpara_phyloP_scores%2CCanLod_phyloP_scores%2CCTG_phyloP_scores%2CSacc_phyloP_scores%2Cholland_wt_plnk_1_coverage&highlight= <i>C. parapsilosis</i> in JBrowse]==
==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_parapsilosis_CDC317&loc=Contig005569_C_parapsilosis_CDC317%3A2164961..2179340&tracks=DNA%2CTranscribed%20Features%2Cpara_phyloP_scores%2CCanLod_phyloP_scores%2CCTG_phyloP_scores%2CSacc_phyloP_scores%2Cholland_wt_plnk_1_coverage&highlight= <i>C. parapsilosis</i> in JBrowse]==
 
<div class="mw-collapsible mw-collapsed">
*[https://pubmed.ncbi.nlm.nih.gov/23895281/ Connolly, et al., 2013]. The APSES transcription factor <i>Efg1</i> is a global regulator that controls morphogenesis and biofilm formation in <i>Candida parapsilosis</i>. Mol Microbiol. 2013 Oct;90(1):36-53.
*[https://pubmed.ncbi.nlm.nih.gov/23895281/ Connolly, et al., 2013]. The APSES transcription factor <i>Efg1</i> is a global regulator that controls morphogenesis and biofilm formation in <i>Candida parapsilosis</i>. Mol Microbiol. 2013 Oct;90(1):36-53.
*[https://pubmed.ncbi.nlm.nih.gov/22192698/ Guida et al., 2011]. Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast <i>Candida parapsilosis</i>. BMC Genomics. 2011 Dec 22:12:628.
*[https://pubmed.ncbi.nlm.nih.gov/22192698/ Guida et al., 2011]. Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast <i>Candida parapsilosis</i>. BMC Genomics. 2011 Dec 22:12:628.
 
</div>
==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_dubliniensis_CD36&loc=Chr1_C_dubliniensis_CD36%3A131099..145478&tracks=DNA%2CTranscribed%20Features%2Calb_dub_phyloP_scores%2CCanLod_phyloP_scores%2CCTG_phyloP_scores%2CSacc_phyloP_scores&highlight= <i>C. dubliniensis</i> in JBrowse]==
==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_dubliniensis_CD36&loc=Chr1_C_dubliniensis_CD36%3A131099..145478&tracks=DNA%2CTranscribed%20Features%2Calb_dub_phyloP_scores%2CCanLod_phyloP_scores%2CCTG_phyloP_scores%2CSacc_phyloP_scores&highlight= <i>C. dubliniensis</i> in JBrowse]==
 
<div class="mw-collapsible mw-collapsed">
*[https://pubmed.ncbi.nlm.nih.gov/23547856/ Grumaz et al., 2013]. Species and condition specific adaptation of the transcriptional landscapes in <i>Candida albicans</i> and <i>Candida dubliniensis</i>. BMC Genomics. 2013 Apr 2:14:212.
*[https://pubmed.ncbi.nlm.nih.gov/23547856/ Grumaz et al., 2013]. Species and condition specific adaptation of the transcriptional landscapes in <i>Candida albicans</i> and <i>Candida dubliniensis</i>. BMC Genomics. 2013 Apr 2:14:212.
*[https://pubmed.ncbi.nlm.nih.gov/33723044/ Singh-Babakh et al., 2021]. Lineage-specific selection and the evolution of virulence in the <i>Candida</i> clade. Proc Natl Acad Sci U S A. 2021 Mar 23;118(12):e2016818118.
*[https://pubmed.ncbi.nlm.nih.gov/33723044/ Singh-Babakh et al., 2021]. Lineage-specific selection and the evolution of virulence in the <i>Candida</i> clade. Proc Natl Acad Sci U S A. 2021 Mar 23;118(12):e2016818118.
 
</div>
==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_glabrata_CBS138&loc=ChrL_C_glabrata_CBS138%3A1176133..1190402&tracks=DNA%2CTranscribed%20Features%2Cglab_phyloP_scores%2CCanNak_phyloP_scores%2CWGD_phyloP_scores%2CSacc_phyloP_scores%2Clinde_ypd_1_coverage&highlight= <i>C. glabrata</i> in JBrowse]==
==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_glabrata_CBS138&loc=ChrL_C_glabrata_CBS138%3A1176133..1190402&tracks=DNA%2CTranscribed%20Features%2Cglab_phyloP_scores%2CCanNak_phyloP_scores%2CWGD_phyloP_scores%2CSacc_phyloP_scores%2Clinde_ypd_1_coverage&highlight= <i>C. glabrata</i> in JBrowse]==
 
<div class="mw-collapsible mw-collapsed">
*[https://pubmed.ncbi.nlm.nih.gov/34591857/ Vu, et al., 2021]. The <i>Candida glabrata Upc2A</i> transcription factor is a global regulator of antifungal drug resistance pathways. PLoS Genet. 2021 Sep 30;17(9):e1009582.
*[https://pubmed.ncbi.nlm.nih.gov/34591857/ Vu, et al., 2021]. The <i>Candida glabrata Upc2A</i> transcription factor is a global regulator of antifungal drug resistance pathways. PLoS Genet. 2021 Sep 30;17(9):e1009582.
*[https://pubmed.ncbi.nlm.nih.gov/37891489/ Ni, et al., 2023]. The regulatory subunits of CK2 complex mediate DNA damage response and virulence in <i>Candida glabrata</i>. BMC Microbiol. 2023 Oct 28;23(1):317.  
*[https://pubmed.ncbi.nlm.nih.gov/37891489/ Ni, et al., 2023]. The regulatory subunits of CK2 complex mediate DNA damage response and virulence in <i>Candida glabrata</i>. BMC Microbiol. 2023 Oct 28;23(1):317.  
Line 1,099: Line 1,362:
*[https://pubmed.ncbi.nlm.nih.gov/36108742/ Bhakt et al., 2022]. The SET-domain protein <i>CgSet4</i> negatively regulates antifungal drug resistance via the ergosterol biosynthesis transcriptional regulator <i>CgUpc2a</i>. J Biol Chem. 2022 Oct;298(10):102485.
*[https://pubmed.ncbi.nlm.nih.gov/36108742/ Bhakt et al., 2022]. The SET-domain protein <i>CgSet4</i> negatively regulates antifungal drug resistance via the ergosterol biosynthesis transcriptional regulator <i>CgUpc2a</i>. J Biol Chem. 2022 Oct;298(10):102485.
*[https://pubmed.ncbi.nlm.nih.gov/25586221/ Linde et al., 2015]. Defining the transcriptomic landscape of <i>Candida glabrata</i> by RNA-Seq. Nucleic Acids Res. 2015 Feb 18;43(3):1392-406.
*[https://pubmed.ncbi.nlm.nih.gov/25586221/ Linde et al., 2015]. Defining the transcriptomic landscape of <i>Candida glabrata</i> by RNA-Seq. Nucleic Acids Res. 2015 Feb 18;43(3):1392-406.
 
</div>
==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_auris_B8441&loc=PEKT02000010_C_auris_B8441%3A118601..133000&tracks=DNA%2CTranscribed%20Features%2Cauris_phyloP_scores%2CAurLus_phyloP_scores%2CCTG_phyloP_scores%2CSacc_phyloP_scores&highlight= <i>C. auris</i> in JBrowse]==
==[http://www.candidagenome.org/jbrowse/index.html?data=cgd_data%2FC_auris_B8441&loc=PEKT02000010_C_auris_B8441%3A118601..133000&tracks=DNA%2CTranscribed%20Features%2Cauris_phyloP_scores%2CAurLus_phyloP_scores%2CCTG_phyloP_scores%2CSacc_phyloP_scores&highlight= <i>C. auris</i> in JBrowse]==
 
<div class="mw-collapsible mw-collapsed">
*[https://pubmed.ncbi.nlm.nih.gov/35412372/ Simm, et al., 2022]. Disruption of iron homeostasis and mitochondrial metabolism are promising targets to inhibit <i>Candida auris</i>. Microbiol Spectr 2022 Apr 27;10(2):e0010022.
*[https://pubmed.ncbi.nlm.nih.gov/35412372/ Simm, et al., 2022]. Disruption of iron homeostasis and mitochondrial metabolism are promising targets to inhibit <i>Candida auris</i>. Microbiol Spectr 2022 Apr 27;10(2):e0010022.
*[https://pubmed.ncbi.nlm.nih.gov/34643421/ Jakab, et al., 2021]. Transcriptional profiling of the <i>Candida auris</i> response to exogenous farnesol exposure mSphere. 2021 Sep-Oct; 6(5): e00710-21.
*[https://pubmed.ncbi.nlm.nih.gov/34643421/ Jakab, et al., 2021]. Transcriptional profiling of the <i>Candida auris</i> response to exogenous farnesol exposure mSphere. 2021 Sep-Oct; 6(5): e00710-21.
Line 1,110: Line 1,373:
*[https://pubmed.ncbi.nlm.nih.gov/35652307/ Shivarathri, et al., 2022]. Comparative transcriptomics reveal possible mechanisms of amphotericin B resistance in <i>Candida auris</i>. Antimicrob Agents Chemother. 2022 Jun 21;66(6):e0227621.
*[https://pubmed.ncbi.nlm.nih.gov/35652307/ Shivarathri, et al., 2022]. Comparative transcriptomics reveal possible mechanisms of amphotericin B resistance in <i>Candida auris</i>. Antimicrob Agents Chemother. 2022 Jun 21;66(6):e0227621.
*[https://pubmed.ncbi.nlm.nih.gov/38466738/ Pelletier, et al., 2024]. <i>Candida auris</i> undergoes adhesin-dependent and -independent cellular aggregation. PLoS Pathog. 2024 Mar 11;20(3):e1012076
*[https://pubmed.ncbi.nlm.nih.gov/38466738/ Pelletier, et al., 2024]. <i>Candida auris</i> undergoes adhesin-dependent and -independent cellular aggregation. PLoS Pathog. 2024 Mar 11;20(3):e1012076
</div>
=Newsletter Archives=
== CGD Newsletter, Spring 2026 ==
<div class="mw-collapsible mw-collapsed">
=== About this newsletter ===
The goals of the CGD newsletter are to connect with the Candida community, inform researchers about new features in the database, and solicit input from you, our community members. Given that we strive to read most Candida reports, we will also offer "research spotlights" on intriguing new results.
Please feel free to make suggestions for the newsletter and/or the research spotlight by [[Special:Contact|contacting us]].
----
=== CGD IS GETTING REMODELLED! ===
This is the biggest announcement in many years. You'll soon see a brand-new appearance for CGD that includes:
# A cleaner interface that makes it easier to find what you need
# An organism selector added to many pages, allowing you to switch quickly between species
# Newly searchable tables that allow you to filter the results and/or sort by column
# A brand-new Literature Topic Search tool that allows you to search by topic tag, so you can quickly find all the papers/features related to a given topic or combination of topics. <br>[[File:Literature Text Search.png|400px|thumb|center]]
# A brand-new Text Search tool, making it possible to mine CGD data in ways that haven't been possible. <br>[[File:Text Search Tool.png|400px|thumb|center]]
# Revisions of outdated pages, including a new "What Is GO?" page that serves as an introduction for trainees
# Upgrades to the latest version of JBrowse 2 with the CGD classic style. The visual layout stays nearly identical, but improvements include:
## Faster rendering (WebGL improvements)
## Better large track handling
## Improved plugin system
## Improved session handling
## Better remote file support
# Updated "Genome Snapshots" for each species, now including distributions of GO terms within each category of function, process, and component
# New "CGD Paper" pages that list all the phenotypes and GO terms derived from that paper
# New "quick links" on the homepage under "CGD Curation News," including one to Disease-related papers. Access the newest literature related to candidiasis in a rapid search.
# Improved tools that allow for using larger datasets, including the GO Term Finder.
# Introduced CGD Swagger UI, offering a convenient way to retrieve data programmatically. This includes an interactive API Playground for testing endpoints and generating Python and R code snippets.
# New Synteny Viewer for the species within CGD, available from the Tools menu or on the Homologs page for each locus
To what do we owe this embarrassment of riches? Our new programmer/developer stepped in just a couple months ago and quickly began building improved tools.
That said, we fully expect there will still be bugs and small fixes to make on the new site. Please get in touch whenever you find something that doesn't seem to work correctly. Also, we are open to suggestion for further improvements, so feel free to share your ideas.
----
=== Research Spotlight: Fungal extracellular vesicles mediate conserved cross-species communication and immunomodulation ===
Continuing with the theme of crosstalk within the mammalian host, a recent study examines how fungi employ extracellular vesicles (EVs) for this specific purpose. Piraine et al. describe in a recent ''mBio'' paper that fungi use EVs to not only communicate within their own species, but also with other fungal species and with the host.
The study looks at use of EV communication for two ''Candida'' spp. (''C. albicans'' and ''C. auris'') and two ''Cryptococcus'' spp. (''C. neoformans'' and ''C. gattii''). Study of EVs began in ''C. neoformans'' in 2007. Now, after isolating EVs from each species, the researchers labeled them to track "receipt" by other cells. Their study shows that EVs are first recognized and bound at the cell surface, after which they may or may not be internalized. (The yellow arrows in the figure indicate interaction.)
[[File:Figure 1.png|600px|thumb|center]]
They found that a given species not only recognizes its own EVs but also those produced by near relatives. Further, an inter-phylum association was seen in ''C. auris'' recognizing EVs produced by ''C. neoformans''. This is an intriguing result.
A next set of experiments looked at the role of EV-mediated communication on biofilm adhesion and dispersal. For both ''C. albicans'' and ''C. auris'', concentrations of EVs from either species above a certain number (10 EVs per cell in a well) consistently increased both biofilm adhesion and dispersal. Further, application of EVs from either species to itself or the other led to increased expression of ERG11 and increased resistance to fluconazole. It thus appears that what EVs deliver contribute to both virulence and resistance, tilting the balance in favor of the pathogen.
[[File:Figure 2.png|600px|thumb|center]]
With respect to crosstalk between pathobiont fungi and the host, it has been established that fungal EVs carry factors that act as pathogen-associated molecular patterns (PAMPs), which activate the innate immune response (see Brown et al., 2024 for review). These factors are typically fungal cell wall proteins that mammals do not produce, thus are recognized as foreign by immune pattern recognition receptors (PRRs).
Curious about this interaction, the researchers introduced fungal EVs to THP-1 macrophage-like cells and then measured signaling events. They detected an increase in STAT1 signaling linked to M1-type activated macrophages, which then led to downstream immune responses including altered transcription patterns and cytokine production associated with the pro-inflammatory response. Thus, immune cells are recognizing fungi as pathogens via materials contained within EVs and launching a defense.
A particularly interesting finding was the upregulation of the macrophage TLR9 receptor in response to ''C. albicans'' and ''C. auris'' EVs, which the authors speculate to contain chitin and nucleic acids. In contrast, ''C. gattii'' EVs trigger the opposite effect of downregulating TLR9, which could be a form of immune evasion.
[[File:Figure 3.png|700px|thumb|center]]
The concept that fungal EVs are pivotal to intra- and interspecies communication is a relatively hot new topic, for which CGD recently added a literature topic tag due to the number of papers coming out. However, the nature of the information being communicated by vesicles largely remains unknown. Fungi are likely exchanging "news" of the environment, toward either assisting or hampering certain neighbors within the microbiome. The results of this paper show clear assistance between related fungi.


=Community Resources=
The communication between fungi and their hosts, however, is harder to interpret. Are immune cells "intercepting" EVs that are meant for other fungi? Or, in the case of the TLR9 repression by ''C. gattii'', have fungi evolved a means to evade detection by sending out vesicles to "disarm" the receptors?


=JB Test=
Future studies will have these intriguing questions to tackle.
==[[Test Page]]==
</div>
[[Image:JBrowse.png|750px]]

Latest revision as of 20:23, 24 March 2026

Welcome to the CGD Public Wiki

Seminal Candida Papers

C. albicans

Cell Biology

AUTOPHAGY

CELL CYCLE

  • Barton R, Gull K. Variation in cytoplasmic microtubule organization and spindle length between the two forms of the dimorphic fungus Candida albicans. J Cell Sci. 1988 Oct;91 ( Pt 2):211-20.
  • Berman, J. Morphogenesis and cell cycle progression in Candida albicans. 2006 Dec;9(6):595-601. Epub 2006 Oct 20.
  • Chapa y Lazo B, Bates S, Sudbery P. The G1 cyclin Cln3 regulates morphogenesis in Candida albicans. Eukaryot Cell. 2005 Jan;4(1):90-4.
  • Cote P, Hogues H, Whiteway M. Transcriptional analysis of the Candida albicans cell cycle. Mol Biol Cell. 2009 Jul;20(14):3363-73. Epub 2009 May 28.
  • Finley KR, Berman J. Microtubules in Candida albicans hyphae drive nuclear dynamics and connect cell cycle progression to morphogenesis. Eukaryot Cell. 2005 Oct;4(10):1697-711.
  • Singh A, Sharma S, Khuller GK. cAMP regulates vegetative growth and cell cycle in Candida albicans. Mol Cell Biochem. 2007 Oct;304(1-2):331-41. Epub 2007 Jun 8.

CELL WALL

CO2 SENSING

  • Mitchell AP. Fungal CO2 sensing: a breath of fresh air. Curr Biol. 2005 Nov 22;15(22):R934-6.
  • Mock RC, Pollack JH, Hashimoto T. Carbon dioxide induces endotrophic germ tube formation in Candida albicans. Can J Microbiol. 1990 Apr;36(4):249-53.
  • Sims W. Effect of carbon dioxide on the growth and form of Candida albicans. J Med Microbiol. 1986 Nov;22(3):203-8.
  • Webster CE, Odds FC. Growth of pathogenic Candida isolates anaerobically and under elevated concentrations of CO2 in air. J Med Vet Mycol. 1987 Feb;25(1):47-53. Erratum in: J Med Vet Mycol 1988 Feb;26(1):75.

GENETIC INSTABILITY

  • Selmecki A, Bergmann S, Berman J. Comparative genome hybridization reveals widespread aneuploidy in Candida albicans laboratory strains. Mol Microbiol. 2005 Mar;55(5):1553-65.
  • Selmecki AM, Dulmage K, Cowen LE, Anderson JB, Berman J. Acquisition of aneuploidy provides increased fitness during the evolution of antifungal drug resistance. PLoS Genet. 2009 Oct;5(10):e1000705. Epub 2009 Oct 30.
  • Wu W, Pujol C, Lockhart SR, Soll DR. Chromosome loss followed by duplication is the major mechanism of spontaneous mating-type locus homozygosis in Candida albicans. Genetics. 2005 Mar;169(3):1311-27. Epub 2005 Jan 16.
  • Berman J. Ploidy plasticity: a rapid and reversible strategy for adaptation to stress. FEMS Yeast Res. 2016 May;16(3):fow020.

VACUOLAR DYNAMICS AND INHERITANCE

  • Gow NA, Gooday GW. Growth kinetics and morphology of colonies of the filamentous form of Candida albicans. J Gen Microbiol. 1982 Sep;128(9):2187-94.
  • Gow NA, Gooday GW. A model for the germ tube formation and mycelial growth form of Candida albicans. Sabouraudia. 1984;22(2):137-44.
  • Barelle CJ, Bohula EA, Kron SJ, Wessels D, Soll DR, Schafer A, Brown AJ, Gow NA. Asynchronous cell cycle and asymmetric vacuolar inheritance in true hyphae of Candida albicans. Eukaryot Cell. 2003 Jun;2(3):398-410.
  • Veses V, Gow NA. Vacuolar dynamics during the morphogenetic transition in Candida albicans. FEMS Yeast Res. 2008 Dec;8(8):1339-48.
  • Veses V, Richards A, Gow NA. Vacuole inheritance regulates cell size and branching frequency of Candida albicans hyphae. Mol Microbiol. 2009 Jan;71(2):505-19.

DRUG RESISTANCE MECHANISMS

  • Arana DM, Nombela C, Pla J. Fluconazole at subinhibitory concentrations induces the oxidative- and nitrosative-responsive genes TRR1, GRE2 and YHB1, and enhances the resistance of Candida albicans to phagocytes. J Antimicrob Chemother. 2010 Jan;65(1):54-62.
  • Coste A, Selmecki A, Forche A, Diogo D, Bougnoux ME, d'Enfert C, Berman J, Sanglard D. Genotypic evolution of azole resistance mechanisms in sequential Candida albicans isolates. Eukaryot Cell. 2007 Oct;6(10):1889-904.
  • Cowen LE, Steinbach WJ. Stress, drugs, and evolution: the role of cellular signaling in fungal drug resistance. Eukaryot Cell. 2008 May;7(5):747-64.
  • Manoharlal R, Gorantala J, Sharma M, Sanglard D, Prasad R. PAP1 [poly(A) polymerase 1] homozygosity and hyperadenylation are major determinants of increased mRNA stability of CDR1 in azole-resistant clinical isolates of Candida albicans. Microbiology. 2010 Feb;156(Pt 2):313-26.
  • Morschhauser J. Regulation of multidrug resistance in pathogenic fungi. Fungal Genet Biol. 2010 Feb;47(2):94-106.
  • Odds FC. In Candida albicans, resistance to flucytosine and terbinafine is linked to MAT locus homozygosity and multilocus sequence typing clade 1. FEMS Yeast Res. 2009 Oct;9(7):1091-101.
  • Peman J, Canton E, Espinel-Ingroff A. Antifungal drug resistance mechanisms. Expert Rev Anti Infect Ther. 2009 May;7(4):453-60.
  • Rustad TR, Stevens DA, Pfaller MA, White TC. Homozygosity at the Candida albicans MTL locus associated with azole resistance. Microbiology. 2002 Apr;148(Pt 4):1061-72.
  • Sanglard D, Coste A, Ferrari S. Antifungal drug resistance mechanisms in fungal pathogens from the perspective of transcriptional gene regulation. FEMS Yeast Res. 2009 Oct;9(7):1029-50.
  • Selmecki AM, Dulmage K, Cowen LE, Anderson JB, Berman J. Acquisition of aneuploidy provides increased fitness during the evolution of antifungal drug resistance. PLoS Genet. 2009 Oct;5(10):e1000705.
  • Nishimoto AT, Sharma C, Rogers PD. Molecular and genetic basis of azole antifungal resistance in the opportunistic pathogenic fungus Candida albicans. J Antimicrob Chemother. 2020 Feb 1;75(2):257-270.

Transformation/Response

BIOFILMS

CHLAMYDOSPORE DEVELOPMENT

HYPOXIA

  • Ernst JF, Tielker D. Responses to hypoxia in fungal pathogens. Cell Microbiol. 2009 Feb;11(2):183-90.
  • Mulhern SM, Logue ME, Butler G. Candida albicans transcription factor Ace2 regulates metabolism and is required for filamentation in hypoxic conditions. Eukaryot Cell. 2006 Dec;5(12):2001-13.
  • Setiadi ER, Doedt T, Cottier F, Noffz C, Ernst JF. Transcriptional response of Candida albicans to hypoxia: linkage of oxygen sensing and Efg1p-regulatory networks. J Mol Biol. 2006 Aug 18;361(3):399-411.
  • Stichternoth C, Ernst JF. Hypoxic adaptation by Efg1 regulates biofilm formation by Candida albicans. Appl Environ Microbiol. 2009 Jun;75(11):3663-72.

MATING AND THE PARASEXUAL CYCLE

MORPHOGENESIS AND POLARIZED CELL GROWTH

  • Gow NA, Gooday GW. Growth kinetics and morphology of colonies of the filamentous form of Candida albicans. J Gen Microbiol. 1982 Sep;128(9):2187-94.
  • Gow NA, Gooday GW. Vacuolation, branch production and linear growth of germ tubes in Candida albicans. J Gen Microbiol. 1982 Sep;128(9):2195-8.
  • [https://pubmed.ncbi.nlm.nih.gov/3319423/ Gow NA, Gooday GW. Cytological aspects of dimorphism in Candida albicans. Crit Rev Microbiol. 1987;15(1):73-8.
  • Gow NA. Germ tube growth of Candida albicans. Curr Top Med Mycol. 1997 Dec;8(1-2):43-55.
  • Berman, J. Morphogenesis and cell cycle progression in Candida albicans. 2006 Dec;9(6):595-601.
  • Sinha I, Wang YM, Philp R, Li CR, Yap WH, Wang Y. Cyclin-dependent kinases control septin phosphorylation in Candida albicans hyphal development. Dev Cell. 2007 Sep;13(3):421-32.
  • Veses V, Gow NA. Vacuolar dynamics during the morphogenetic transition in Candida albicans. FEMS Yeast Res. 2008 Dec;8(8):1339-48.
  • Veses V, Richards A, Gow NA. Vacuole inheritance regulates cell size and branching frequency of Candida albicans hyphae. Mol Microbiol. 2009 Jan;71(2):505-19.
  • Wang Y. CDKs and the yeast-hyphal decision. Curr Opin Microbiol. 2009 Dec;12(6):644-9.
  • Whiteway M, Bachewich C. Morphogenesis in Candida albicans. Annu Rev Microbiol. 2007;61:529-53.
  • Du H, Ennis CL, Hernday AD, Nobile CJ, Huang G. N-Acetylglucosamine (GlcNAc) Sensing, Utilization, and Functions in Candida albicans. J Fungi (Basel). 2020 Aug 7;6(3):129.

WHITE-OPAQUE SWITCHING

PH RESPONSE

  • Bensen ES, Martin SJ, Li M, Berman J, Davis DA. Transcriptional profiling in Candida albicans reveals new adaptive responses to extracellular pH and functions for Rim101p. Mol Microbiol. 2004 Dec;54(5):1335-51.
  • Davis DA. How human pathogenic fungi sense and adapt to pH: the link to virulence. Curr Opin Microbiol. 2009 Aug;12(4):365-70.
  • Davis D. Adaptation to environmental pH in Candida albicans and its relation to pathogenesis. Curr Genet. 2003 Oct;44(1):1-7. Erratum in: Curr Genet. 2003 Oct;44(1):58.
  • Davis D, Wilson RB, Mitchell AP. RIM101-dependent and-independent pathways govern pH responses in Candida albicans. Mol Cell Biol. 2000 Feb;20(3):971-8.
  • Kullas AL, Martin SJ, Davis D. Adaptation to environmental pH: integrating the Rim101 and calcineurin signal transduction pathways. Mol Microbiol. 2007 Nov;66(4):858-71.
  • Ramon AM, Fonzi WA. Diverged binding specificity of Rim101p, the Candida albicans ortholog of PacC. Eukaryot Cell. 2003 Aug;2(4):718-28.
  • Ramon AM, Porta A, Fonzi WA. Effect of environmental pH on morphological development of Candida albicans is mediated via the PacC-related transcription factor encoded by PRR2. J Bacteriol. 1999 Dec;181(24):7524-30.

QUORUM SENSING

STRESS RESPONSES

  • Alonso-Monge R, Roman E, Arana DM, Pla J, Nombela C. Fungi sensing environmental stress. Clin Microbiol Infect. 2009 Jan;15 Suppl 1:17-9.
  • Arana DM, Nombela C, Pla J. Fluconazole at subinhibitory concentrations induces the oxidative- and nitrosative-responsive genes TRR1, GRE2 and YHB1, and enhances the resistance of Candida albicans to phagocytes. J Antimicrob Chemother. 2010 Jan;65(1):54-62.
  • Deveau A, Piispanen AE, Jackson AA, Hogan DA. Farnesol induces hydrogen peroxide resistance in Candida albicans yeast by inhibiting the Ras-cyclic AMP signaling pathway. Eukaryot Cell. 2010 Apr;9(4):569-77.
  • Reedy JL, Filler SG, Heitman J. Elucidating the Candida albicans calcineurin signaling cascade controlling stress response and virulence. Fungal Genet Biol. 2010 Feb;47(2):107-16.
  • Rodaki A, Bohovych IM, Enjalbert B, Young T, Odds FC, Gow NA, Brown AJ. Glucose promotes stress resistance in the fungal pathogen Candida albicans. Mol Biol Cell. 2009 Nov;20(22):4845-55.
  • Berman J. Ploidy plasticity: a rapid and reversible strategy for adaptation to stress. FEMS Yeast Res. 2016 May;16(3):fow020.

THIGMOTROPISM, GALVANOTROPISM AND CONTACT-SENSING

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE AND VIRULENCE FACTORS

C. glabrata

Cell Biology

CELL WALL

GENE SILENCING

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

MATING AND MATING LOCI

PHENOTYPIC SWITCHING

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE FACTORS

C. parapsilosis

Cell Biology

CELL WALL

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

ADHESION

MATING LOCI

PHENOTYPIC SWITCHING

STRESS RESPONSE

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE FACTORS

C. auris

Cell Biology

CELL WALL

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

ADHESION

MATING LOCI

PHENOTYPIC SWITCHING


STRESS RESPONSE

Virulence

HOST-PATHOGEN INTERACTIONS


VIRULENCE FACTORS

C. dubliniensis

Cell Biology

CELL WALL

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

ADHESION

MATING LOCI

CHLAMYDOSPORE DEVELOPMENT

FILAMENTATION

STRESS RESPONSE

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE FACTORS

C. tropicalis

Cell Biology

CELL WALL

DRUG RESISTANCE MECHANISMS

Transformation/Response

BIOFILMS

ADHESION

  • Bendel CM, Hostetter MK. Distinct mechanisms of epithelial adhesion for Candida albicans and Candida tropicalis. Identification of the participating ligands and development of inhibitory peptides. J Clin Invest. 1993 Oct;92(4):1840-9.
  • de Souza CM, Dos Santos MM, Furlaneto-Maia L, Furlaneto MC. Adhesion and biofilm formation by the opportunistic pathogen Candida tropicalis: what do we know? Can J Microbiol. 2023 Jun 1;69(6):207-218. (Review)

MATING AND MATING LOCI

FILAMENTATION

STRESS RESPONSE

Virulence

HOST-PATHOGEN INTERACTIONS

VIRULENCE FACTORS

Current Taxonomy

The genus Candida was originally formed as a heterogeneous grouping of opportunistic pathogenic budding yeasts that lacked sexual reproduction (Groenewald et al., 2023). Further genomic study has revealed evolutionary distances between these species that argues for taxonomic revision within the budding yeast subphylum Saccharomycotina (Shen et al., 2020, Liu et al., 2024, Kidd et al., 2023). Interestingly, it appears pathogenicity within humans has evolved multiple times in this subphylum (Rokas, 2022)

NCBI has recently announced adoption of new taxonomy that affects the Candida community.

The specific name changes are as follows:

  • Clavispora lusitaniae (syn. Candida lusitaniae )
  • Pichia kudriavzevii (syn. Candida krusei )
  • Meyerozyma guilliermondii (syn. Candida guilliermondii )
  • Nakaseomyces glabratus (syn. Candida glabrata )
  • Candidozyma auris (syn. Candida auris )

Strain Information

Candida albicans Strains

SC5314

Genotype: wild type

Notes: Wild-type strain used in the systematic sequencing project, the reference sequence stored in CGD. The original strain background from which most of the common laboratory strains are derived. This strain is virulent in a mouse model of systemic infection and is frequently used as a wild-type control. In their 2004 Genome Biology paper on C. albicans genome sequence, Frank Odds, Al Brown and Neil Gow explain the origins of SC5314: "Strain SC5314 was used in the 1980s by scientists at the E.R. Squibb company (now Bristol-Myers Squibb, see Note1) for their pioneering studies of C. albicans molecular biology. It was engineered by Fonzi and Irwin to provide the uridine autotrophic mutant that has been essential to most subsequent molecular genetic research into C. albicans. The strain is usually described merely as a 'clinical isolate', but it is worth setting on record that SC5314 was originally isolated from a patient with generalized Candida infection by Margarita Silva-Hutner (see Note 2) at the Department of Dermatology, Columbia College of Physicians and Surgeons (New York, USA). The original isolate number was 1775 and the strain is identical with strain NYOH#4657 in the New York State Department of Health collection. (This information was provided by Joan Fung-Tome at Bristol-Myers Squibb as a personal communication.) SC5314 belongs to the predominant clade of closely related C. albicans strains that represents almost 40% of all isolates worldwide, as determined by DNA fingerprinting and multi-locus sequence typing (A. Tavanti, A.D. Davidson, N.A.R.G., M.C.J. Maiden and F.C.O., unpublished observations)."

Note 1: The earliest publications that used SC5314 came in 1968 from Squibb Institute for Medical Research.

Note 2: The documentation of the work done by Margarita Silva-Hutner and her lab is preserved at Columbia University Archival Collections.

References: Odds et al., 2004. Genome Biol. 2004; 5(7): 230; Fonzi and Irwin, 1993. 1993 Jul;134(3):717-28; Aszalos et al., 1968. J Antibiot (Tokyo). 1968 Oct;21(10):611-5; Maestrone and Semar, 1968. Naturwissenschaften. 1968 Feb;55(2):87-8; Meyers et al., 1968. Appl Microbiol. 1968 Apr;16(4):603-8.

BWP17

Genotype: ura3::imm434/ura3::imm434 iro1/iro1::imm434 his1::hisG/his1::hisG arg4/arg4

Notes: Isogenic to the SC5314 strain. Uridine, histidine and arginine auxotroph derived from the RM1000 strain by deletion of the ARG4 gene. This strain has a heterozygous deletion on chromosome 5 that was inherited from the RM1000 parental strain.

References: Wilson et al., 1999. J Bacteriol. 1999 Mar;181(6):1868-74.

CAF2-1

Genotype: URA3/ura3::imm434 IRO1/iro1::imm434

Notes: URA3 heterozygous strain derived from the SC5314 strain. The 3-prime end of one copy of the IRO1 gene that resides adjacent to URA3 was inadvertently deleted during the construction of this strain. This strain is virulent in a mouse model of systemic infection and is frequently used as a wild-type control.

References: Fonzi and Irwin, 1993. Genetics 1993 Jul;134(3):717-28.

CAI4

Genotype: ura3::imm434/ura3::imm434 iro1/iro1::imm434

Notes: Isogenic to the SC5314 strain. Uridine auxotroph constructed by deletion of the second copy of URA3. The second copy of IRO1 was inadvertently deleted upon strain construction. As a result, the strain and its descendants have no functional copy of IRO1. This strain is avirulent in a mouse model of systemic infection unless complemented with URA3.

References: Fonzi and Irwin, 1993. Genetics 1993 Jul;134(3):717-28; Garcia et al., 2001. Yeast. 2001 Mar 15;18(4):301-11.

CAI8

Genotype: ura3::imm434/ura3::imm434 iro1/iro1::imm434 ade2::hisG/ade2::hisG

Notes: Isogenic to the SC5314 strain. Derived from the CAF2-1 strain by deletion of URA3 and both copies of ADE2 using the URA-blaster method.

References: Fonzi and Irwin, 1993. Genetics 1993 Jul;134(3):717-28.

P37005

Genotype: MTLa/MTLa

Notes: Wild-type clinical isolate. Naturally homozygous for the MTLa mating type locus.

References: Lockhart et al., 2002. Genetics. 2002 Oct;162(2):737-45.

Red3/6

Genotype: ade2/ade2

Notes: Isogenic to the WO-1 strain. Adenine auxotroph derived from the WO-1 strain by chemical mutagenesis using MNNG.

References: Srikantha et al., 1995. Mol Cell Biol. 1995 Mar;15(3):1797-805.

RM1000

Genotype: ura3::imm434/ura3::imm434 iro1/iro1::imm434 his1::hisG/his1::hisG

Notes: Isogenic to the SC5314 strain. Derived from the CAI4 strain by deletion of the HIS1 gene using the URA-blaster method (see Fonzi and Irwin, 1993 for details of this method). The standard RM1000 strain was found to have a heterozygous deletion on chromosome 5. RM1000#2 is an isolate that has been shown to have wild-type copies of chromosome 5.

References: Negredo et al., 1997. Microbiology. 1997 Feb;143 ( Pt 2):297-302.

SN87

Genotype: ura3::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2

Notes: Isogenic to the SC5314 strain. Histidine and leucine auxotroph derived from the RM1000#2 strain by deletion of the LEU2 gene. This strain is virulent in a mouse model of systemic infection.

References: Noble and Johnson, 2005. Eukaryot Cell. 2005 Feb;4(2):298-309.

SN95

Genotype: ura3::imm434::URA3/ura3iro1IRO1/iro1his1his1arg4/arg4

Notes: Isogenic to the SC5314 strain. Histidine and arginine auxotroph derived from the RM1000#2 strain by deletion of the ARG4 gene. This strain is virulent in a mouse model of systemic infection.

References: Noble and Johnson, 2005. Eukaryot Cell. 2005 Feb;4(2):298-309.

SN152

Genotype: ura3/::imm434::URA3/ura3::imm434 iro1::IRO1/iro1::imm434 his1::hisG/his1::hisG leu2/leu2 arg4/arg4

Notes: Isogenic to the SC5314 strain. Histidine, leucine and arginine auxotroph derived from the RM1000#2 strain by deletion of the LEU2 and ARG4 genes. This strain is virulent in a mouse model of systemic infection.

References: Noble and Johnson, 2005. Eukaryot Cell. 2005 Feb;4(2):298-309.

SN250

Genotype: his1Δ/his1Δ, leu2Δ::C.dubliniensis HIS1 /leu2Δ::C.maltosa LEU2, arg4Δ /arg4Δ, URA3/ura3Δ::imm434, IRO1/iro1Δ::imm434

Notes: Isogenic to the SC5314 strain. Derived from SN87 by integration of C. dubliniensis HIS1 and C. maltosa LEU2 at the disrupted leu2 loci and then deleted for arg4. Derived from SN87 and QMY23.

References: Noble et al., 2010. Nat Genet. 2010 Jul;42(7):590-8;

Mitrovich et al., 2007. Genome Res. 2007 Apr;17(4):492-502.

WO-1

Genotype: MTLalpha

Notes: Wild-type clinical isolate that switches between white and opaque phenotypes at high frequency. The MTLa locus is absent in this strain (for more information see Lockhart et al., 2002). This strain has been sequenced by the Broad Institute (http://www.broadinstitute.org/annotation/genome/candida_group/GenomeDescriptions.html)

References: Slutsky et al., 1987. J Bacteriol. 1987 Jan;169(1):189-97; Lockhart et al., 2002. Genetics. 2002 Oct;162(2):737-45.

WUM5A

Genotype: MTLalpha/MTLalpha ura3-1Δ::FRT/ura3-2Δ::FRT

Notes: Isogenic to the WO-1 strain. Uridine auxotroph constructed by deletion of both copies of URA3.

References: Strauss et al. 2001. J Bacteriol. 2001 Jun;183(12):3761-9.

Candida glabrata (Nakaseomyces glabratus) Strains

B

Genotype: Wild type

Notes: Clinical isolate from a case of vaginitis that did not respond to fluconazole or boric acid treatment; it is virulent in a murine model of vaginitis. This strain was called LF 547.92 in the original publication.

References: Fidel et al., 1996. J Infect Dis. 1996 Feb;173(2):425-31.

BG2

Genotype: Wild type

Notes: Clinical isolate from a case of vaginitis that did not respond to fluconazole or boric acid treatment; it is virulent in a murine model of vaginitis

References: Cormack and Falkow, 1999. Genetics. 1999 Mar;151(3):979-87.

BG14

Genotype: ura3-delta(-285 +932)::Tn903NeoR

Notes: A ura3 derivative of the wild-type B2 clinical isolate.

References: Cormack and Falkow, 1999. Genetics. 1999 Mar;151(3):979-87.

BG462

Genotype: URA3

Notes: A derivative of the B2 clinical isolate with the URA3 gene restored

References: De Las Peñas, et al., 2003. Genes Dev. 2003 Sep 15;17(18):2245-58.

CBS138 (ATCC 2001)

Genotype: Wild type

Notes: Type strain for the Genolevures C. glabrata sequencing project. This strain has also been called NRRL-Y-65 and IFO 0622.

References: Dujon et al., 2004. Nature. 2004 Jul 1;430(6995):35-44; Koszul, et al., 2003. FEBS Lett. 2003 Jan 16;534(1-3):39-48.

2001T

Genotype: trp1

Notes: A trp1 auxotrophic strain derived from the CBS138 (ATCC 2001) wild-type strain.

References: Kitada et al., 1995. Gene. 1995 Nov 20;165(2):203-6.

2001HT

Genotype: his3 trp1::ScURA3

Notes: A his3 trp1 auxotrophic strain derived from 200T, a derivative of the CBS138 (ATCC 2001) wild-type strain.

References: Kitada et al., 1995. Gene. 1995 Nov 20;165(2):203-6.

NCCLS84 (ATCC 90030)

Genotype: Wild type

Notes: Wild-type strain

References: Espinel-Ingroff et al., 1992. J Clin Microbiol. 1992 Dec;30(12):3138-45

84u

Genotype: ura3

Notes: A ura3 derivative of the wild-type NCCLS84 (ATCC90030) strain.

References: Tsai et al., 2006. Antimicrob Agents Chemother. 2006 Apr;50(4):1384-92.

Candida parapsilosis Strains

ATCC 22019

Genotype: heterozygous MET/met

Notes: Application of parasexual genetic methods was used to determine that C. parapsilosis strain ATCC 22019 is is heterozygous MET/met

References: Whelan and Kwon-Chung, 1988. J Med Vet Mycol 1988 Jun;26(3):163-71.

CDC317

Genotype: Wild type

Notes: Reference strain used for the C. parapsilosis sequencing project. This isolate came from the hands of a hospital worker, who was the source for an outbreak of infection in a Mississippi community hospital in 2001.

References: Kuhn et al., 2004. Emerg Infect Dis. 2004 Jun;10(6):1074-81; Clark et al., 2004. J Clin Microbiol. 2004 Oct;42(10):4468-72.

CLIB214 (CBS 604; ATCC 22019; NRRL Y-12969)

Genotype: Wild type

Notes: Type strain, originally isolated from a patient with diarrhea in Puerto Rico by Ashford (1928). This strain is dependent on oxidative metabolism for growth since it lacks a fermentative pathway.

References: Ashford, 1928. Am J Trop Med 8:507�538. In: Kurtzman CP, Fell JW, Boekhout T (eds), 2011. The yeasts: a taxonomic study. p. 987-1278, 5th ed. Elsevier, London, United Kingdom; Logue et al., 2005. Eukaryot Cell 4(6):1009-17.

CPL2

Genotype: leu2Δ::FRT/leu2Δ::FRT, his1Δ::FRT/his1Δ::FRT, frt::CdHIS1

Notes: Leucine auxotroph laboratory strain

References: Németh et al., 2021. Virulence. 2021 Dec;12(1):937-950.

GA1

Genotype: Wild type

Notes: Wild-type clinical isolate. The SAT1 flipper method and the Candida albicans IMH3 gene have been used as dominant-selectable markers to construct gene knockouts in this strain.

References: Gácser et al., 2005. FEMS Microbiol Lett. 2005 Apr 1;245(1):117-21; Gácser et al., 2007. J Clin Invest. 2007 Oct;117(10):3049-58.

SR23 (CBS7157)

Genotype: ade- lys-

Notes: An adenine and lysine auxotroph isolated from a contaminated culture of Saccharomyces cerevisiae as a yeast with peculiar physiological features and carrying a linear mitochondrial DNA

References: Kovac et al., 1984. Mol Gen Genet 197:420-424; Nosek et al., 2004. Mol Genet Genomics 272(2):173-80; Mutalová et al., 2024. Microbiol Resour Announc. 2024 Jul 31;13(9):e00347-24.

Candida auris (Candidozyma auris) Strains

AR0382 (B11109)

Genotype: Wild type

Notes: Aggregative strain with high biofilm formation.

References: Vila et al., 2020. mSphere. 2020 Aug 5;5(4):e00760-20; Wang et al., 2024. Nat Commun. 2024 Oct 25;15(1):9212.

AR0387 (B8441)

Genotype: Wild type

Notes: Reference strain; non-aggregative strain with low biofilm formation.

References: Vila et al., 2020. mSphere. 2020 Aug 5;5(4):e00760-20; Wang et al., 2024. Nat Commun. 2024 Oct 25;15(1):9212.

AR0389

Genotype: erg11-Y132F

Notes: Has high drug resistance due to an ERG11 mutation (Y132F) and overexpression of the drug efflux transporter gene CDR1.

References: Shinohara et al., 2024. JAC Antimicrob Resist. 2024 Feb 21;6(1):dlad155.

AR0390 (B11205)

Genotype: erg11-K143R

Notes: Clinical isolate with high fluconazole resistance.

References: Rybak et al., 2021. Microbiol Spectr. 2021 Dec 8;9(3):e01585-21.

B11220

Genotype: Wild type

Notes: Clade II clinical isolate with susceptibility to all antifungal drugs.

References: Yang et al., 2024. Infect Immun. 2024 Jun 11;92(6):e0010324.

B11221

Genotype: Wild type

Notes: Clade III clinical isolate with resistance to caspofungin. Contains an L-rhamnose utilization cluster that appears to allow more ready use of alternate sugars, better drug tolerance, and better survival from host immune cell attack, possibly due to reduced β-(1,3)-glucans at the cell surface.

References: Yang et al., 2024. Infect Immun. 2024 Jun 11;92(6):e0010324.

Candida tropicalis Strains

ATCC 20336 (pK233)

Genotype: Wild type

Notes: This strain excretes alpha,omega-dicarboxylic acids as a by-product when cultured on n-alkanes or fatty acids as the carbon source.

References: Craft et al., 2003. Appl Environ Microbiol 69(10):5983-91.

ATCC 20913

Genotype: ura3/ura3

Notes: A uracil auxotroph derived from C. tropicalis ATCC 20336 by random mutagenesis.

References: Haas et al., 1990. J Bacteriol 172(8):4571-7.

ATCC 750

Genotype: Wild type

Notes: A wild-type fluconazole susceptible strain.

References: Barchiesi et al., 2000. Antimicrob Agents Chemother 44(6):1578-84.

NCYC2512

Genotype: Wild type

Notes: A wild-type saline soil isolate from Pakistan that is capable of producing large amounts of alpha,omega-dodecanedioic acid.

References: Rodriguez et al., 1996. Yeast 12(13):1321-9.

1230

Genotype: Wild type

Notes: A wild-type dicarboxylic acid-producing industrial strain.

References: He and Chen, 2005. Yeast 22(6):481-91.

Candida dubliniensis Strains

CD36

Genotype: Wild type

Notes: Type strain, oral isolate from an HIV+ patient in Ireland; also catalogued as NCPF 3949 and CBS-7987.

References: Sullivan et al., 1995. Microbiology (Reading) 1995 Jul:141 ( Pt 7):1507-21.

Protocols and Methods

Candida Identification

Universal primers

  • used to amplify ITS genes for subsequent sequencing to identify species
    • Fungi_ITS_Seq_F: GTGAATCATCGAATCTTTGAA
    • Fungi_ITS_Seq_R: TCCTCCGCTTATTGATATGC
    • These are primers ITS86F and ITS4 from the reference Park et al.
    • The primers themselves are from older literature, but this combination seems to work best for yeast species

Candida albicans Protocols and Methods

Candida glabrata (Nakaseomyces glabratus) Protocols and Methods

  • Genetic manipulation of C. glabrata

Candida parapsilosis Protocols and Methods

Candida auris (Candidozyma auris) Protocols and Methods

Candida dubliensis Protocols and Methods

Candida tropicalis Protocols and Methods

Species Comparisons by Topic

Ploidy

Notes: Candida albicans and its close relatives are all on a single phylogenetic branch characterized by diploidy, while the two typical haploid species (C. glabrata and C. auris) are on distinct, distantly related branches for which haploidy is the standard form. Note that the two haploid pathogens are more prone to pleiotropic resistance because only a single mutation is needed in the haploid genome to generate stable change.

References:

Typical diploids

  • C. albicans
  • C. dubliniensis
  • C. parapsilosis
  • C. tropicalis

Typical haploids

  • C. glabrata
  • C. auris

From Munoz et al., 2018

CUG codon usage

Notes: Yeasts of the Candida clade (as opposed to C. glabrata, also known as Nakaseomyces glabratus, which is on the Saccharomyces clade) have undergone an evolutionary reassignment of the CUG codon from leucine to serine. This is due to a novel serine-tRNA (ser-tRNACAG) that contains a guanosine at position 33, a position that is occupied by a pyrimidine (uridine) in nearly all other tRNAs.

References:

Reassigned CUG as serine

  • C. albicans
  • C. dubliniensis
  • C. parapsilosis
  • C. tropicalis
  • C. auris

Standard CUG as leucine

  • C. glabrata


From Butler et al., 2009

Mitochondrial genome

Notes: Candida parapsilosis is unusual in having a mitochondrial genome that is linear and capped by telomeric ends. The close relatives of this species, C. orthopsilosis and C. metapsilosis and Candida subhashii, have a mix of circular and linear mitochondrial genomes. The other Candida spp. are exclusively circular.

References:

Exclusively linear

  • C. parapsilosis

Mix of linear and circular

  • C. orthopsilosis
  • C. metapsilosis
  • C. subhashii

Exclusively circular

  • C. albicans
  • C. dubliniensis
  • C. tropicalis
  • C. auris
  • C. glabrata

From Kosa et al., 2006

Filamentous growth

Notes: Candida spp. vary in filamentous growth as a means of infection/invasion. C. albicans and its close relative C. dubliniensis use true hyphae to penetrate tissues, while C. parapsilosis and C. tropicalis can penetrate tissues by means of pseudohyphae (lacking septa). In contrast, C. glabrata almost never forms filaments and infects in the yeast form. C. auris is an outlier in that it infects both by pseudohyphae and in the yeast form.

Note that the classifications below represent the typical forms for each species, but exceptions are not unusual.

References:

Invasive/infectious by true hyphae

  • C. albicans
  • C. dubliniensis

Invasive/infectious pseudohyphal growth (lacking septa)

  • C. parapsilosis
  • C. tropicalis
  • C. auris

Invasive/infectious as yeast form

  • C. glabrata
  • C. auris

Biofilms

Notes: Candida species all form biofilms but not in the same manner. Biofilms all begin as adherence to a surface and then excretion of an extracellular matrix composed mainly of proteins, carbohydrates, and lipids. All species employ extracellular vesicles to facilitate excretion. They differ in the types of cells that inhabit the biofilm environment.

References:

Biofilms comprising primarily filamentous cells

  • C. albicans
  • C. dubliniensis (but mature biofilms are composed predominately of pseudohyphae rather than true hyphae (26432632)

Biofilms comprising mixed yeast and pseudohyphae

  • C. tropicalis
  • C. parapsilosis
  • C. auris

Biofilms comprising primarily yeast cells

  • C. glabrata

Pathogenicity

Notes: Candida species show heterogeneity in pathogenicity, where each species has a unique profile. See descriptions below.

References:

C. albicans

  • Exclusively commensal, C. albicans is fully adapted to the mammalian host, characterized by high thermotolerance and an advance ability to respond to changes in the body
  • While non-albicans species are increasingly the cause of disease, C. albicans remains the most prevalent pathogen causing candidiasis
  • Virulence properties are extensive, including the ability to (1) switch from the yeast form to the hyphal form; (2) secrete adhesins, biofilm matrix components, proteases, and hydrolytic enzymes; (4) undergo phenotypic change to allow sexual reproduction; (5) adapt metabolic processes to available nutrients; and (6) evade immune responses by various means

C. parapsilosis

  • C. parapsilosis is the second or third most commonly isolated pathogenic species in several parts of the world
  • Can live either commensally or freely in a wide range of ecological niches
  • Has an enhanced ability to adhere to inert surfaces and is thus a particular problem in neonates, transplant recipients, and patients receiving parenteral nutrition

C. tropicalis

  • Can live either commensally or freely in diverse environments
  • More commonly associated with neutropenia and malignancy

C. glabrata

  • Exclusively commensal, with an enormous ability to adapt to various stresses within the human body, including low availability of carbon, iron, and nitrogen, low pH, and both high and low oxygen levels
  • Upon pathogenic invasion, can reach fatality levels of 50%
  • More often associated with adults than children and is thus more prevalent in wealthier nations, where demographics skew to higher average age.

C. dubliniensis

  • As a close relative of C. albicans, C. dubliniensis is a successful colonizer of the human host. However, it primarily lives as a benign commensal and only rarely causes invasive infection
  • When C. dubliniensis does cause infection, it most commonly causes oral candidiasis (see Moyes et al. and Chen et al.)

C. auris

  • C. auris was only recognized as a human pathogen in 2009 and may have only recently evolved the ability to colonize the human host
  • Can live either commensally or freely in a wide range of ecological niches
  • It has been hypothesized that C. auris made the shift to commensalism due to climate change, where increasing terrestrial temperatures made it more possible to bridge the transition into the high-temperature environment inside a mammal
  • As C. auris preferentially colonizes the cooler skin rather than the hotter gut microbiome, new commensalism may be consistent with a recent acquisition of thermotolerance
  • The inclination to colonize skin has made C. auris particularly problematic in hospital settings, where widespread outbreaks have become common

Mating/Reproduction

Notes: Candida species show heterogeneity in mating/reproduction, as described below. References are by species.

C. albicans

  • Undergoes both heterothallic and homothallic reproduction
  • Heterothallic reproduction between two haploids of opposite mating type occurs at low frequency and requires a phenotypic switch from the white to the opaque state, where the opaque state is mating competent
  • Does not appear to undergo mating type switching within a strain
  • Once mating occurs, the fungus does not undergo a meiotic program but instead reduces chromosome number by chromosome loss
  • Parasexual (i.e., homothallic) reproduction via the mating of two diploids is likewise followed by chromosome loss leading to aneuploidy
  • Has a remarkable tolerance for aneuploidy

From Alby and Bennett, 2010

Slutsky et al., 1987 Alby and Bennett, 2010 (review) Butler et al., 2004 Noble and Johnson, 2007 (review)

C. dubliniensis

  • Undergoes mating similarly to C. albicans and is likely to complete the mating cycle by parasexual loss of chromosomes rather than meiosis
  • Requires phenotypic switching from white to opaque before mating
  • Has a higher percentage (~30%) of natural strains that are MTL homozygous (a/a or alpha/alpha) than does C. albicans (~8%)


Pujol et al., 2004 Pujol et al., 2015 Alby and Bennett, 2010 (review) Butler et al., 2004

C. tropicalis

  • Undergoes both homothallic and heterothallic mating, followed by chromosome loss rather than meiosis
  • Tetraploid progeny of homothallic matings can mate with diploid cells of the opposite mating type, generating unstable genomes that give rise to diverse offspring


Du et al., 2018 Alby and Bennett, 2010 (review)

C. parapsilosis

  • Never observed to mate


Alby and Bennett, 2010 (review)

C. glabrata

  • Never observed to mate
  • However, there is genomic evidence for past recombination events and the genome contains the factors shown necessary for meiosis in the close relative S. cerevisiae


Dodgson et al., 2005 Bedekovic and Usher, 2023 (review)

C. auris

  • Never observed to mate
  • However, there is evidence in the genome for past recombination events, especially from before the clades split, and the species appears to contain the necessary factors for mating/meiosis


Muñoz et al., 2018

Drug resistance

Notes: Candida species show distinct drug resistance profiles. While all species can acquire resistance, inherent resistance and/or tolerance is especially concerning for C. auris and C. glabrata, likely due to their haploid genomes.

References:

Concerning levels of inherent azole resistance

  • C. glabrata
  • C. auris
  • C. krusei

Concerning levels of inherent echinocandin resistance

  • C. glabrata
  • C. auris

Concerning levels of amphotericin B resistance

  • C. auris

Acquired resistance in nosocomial settings

  • All species

Resistance within biofilms

  • All species

Respiratory metabolism

Notes: The Crabtree effect explains why baker’s yeast is also called brewer’s yeast, in that S. cerevisiae preferentially converts sugar to alcohol in lieu of other types of respiration. This is referred to as Crabtree positive. Among the pathogenic yeasts, the only member with this ability is the phylogenetic outlier C. glabrata, which is more closely related to S. cerevisiae than to the other pathogenic yeasts. The other pathogenic yeasts are all Crabtree negative, meaning they do not produce alcohol as a product of respiration. For these non-fermentative yeasts, the ability to utilize many carbon sources (with little preference for glucose) is thought to provide an advantage for pathogenesis in various host niches.

References

Crabtree negative (non-fermentative)

  • C. albicans
  • C. dubliniensis
  • C. parapsilosis
  • C. tropicalis
  • C. auris

Crabtree positive (fermentative)

  • C. glabrata

Virulence Factors

Notes: Pathogenic yeasts vary in use of secreted and membrane-bound virulence factors involved in invasion, damage and translocation.

References

From Lim et al., 2021

Datasets Available in CGD

NOTE: To access a specific dataset in JBrowse, click "Select Tracks" at the upper left of the JBrowse page for the species and choose the dataset by first author name.

C. albicans in JBrowse

  • Bruno et al., 2010. Comprehensive annotation of the transcriptome of the human fungal pathogen Candida albicans using RNA-seq. Genome Res. 2010 Oct;20(10):1451-8.
  • Butler et al., 2009. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature. 2009 Jun 4;459(7247):657-62.
  • Desai et al., 2013. Regulatory role of glycerol in Candida albicans biofilm formation. mBio. 2013 Apr 9;4(2):e00637-12.
  • Lohse and Johnson, 2016. Identification and characterization of Wor4, a new transcriptional regulator of white-opaque switching. G3 (Bethesda). 2016 Jan 15;6(3):721-9
  • Muzzy et al., 2013. Assembly of a phased diploid Candida albicans genome facilitates allele-specific measurements and provides a simple model for repeat and indel structure. Genome Biol. 2013;14(9):R97.
  • Niemec et al., 2017. Dual transcriptome of the immediate neutrophil and Candida albicans interplay. BMC Genomics. 2017 Sep 6;18(1):696.
  • Segal et al., 2018. Gene essentiality analyzed by in vivo transposon mutagenesis and machine learning in a stable haploid isolate of Candida albicans. mBio. 2018 Oct 30;9(5):e02048-18.
  • Xie et al., 2013. White-opaque switching in natural MTLa/α isolates of Candida albicans: evolutionary implications for roles in host adaptation, pathogenesis, and sex. PLoS Biol. 2013;11(3):e1001525.
  • Glazier et al., 2023. The Candida albicans reference strain SC5314 contains a rare, dominant allele of the transcription factor Rob1 that modulates filamentation, biofilm formation, and oral commensalism. mBio. 2023 Oct 31;14(5):e0152123.
  • Shivarathri et al., 2019. The fungal histone acetyl transferase Gcn5 controls virulence of the human pathogen Candida albicans through multiple pathways. Sci Rep. 2019 Jul 1;9(1):9445.
  • Rai, et al., 2024. Metabolic reprogramming during Candida albicans planktonic-biofilm transition is modulated by the transcription factors Zcf15 and Zcf26. PLoS Biol. 2024 Jun 21;22(6):e3002693.
  • Zhang, et al. 2024. DNA damage checkpoints govern global gene transcription and exhibit species-specific regulation on HOF1 in Candida albicans. J Fungi (Basel). 2024 May 29;10(6):387.

C. parapsilosis in JBrowse

  • Connolly, et al., 2013. The APSES transcription factor Efg1 is a global regulator that controls morphogenesis and biofilm formation in Candida parapsilosis. Mol Microbiol. 2013 Oct;90(1):36-53.
  • Guida et al., 2011. Using RNA-seq to determine the transcriptional landscape and the hypoxic response of the pathogenic yeast Candida parapsilosis. BMC Genomics. 2011 Dec 22:12:628.

C. dubliniensis in JBrowse

  • Grumaz et al., 2013. Species and condition specific adaptation of the transcriptional landscapes in Candida albicans and Candida dubliniensis. BMC Genomics. 2013 Apr 2:14:212.
  • Singh-Babakh et al., 2021. Lineage-specific selection and the evolution of virulence in the Candida clade. Proc Natl Acad Sci U S A. 2021 Mar 23;118(12):e2016818118.

C. glabrata in JBrowse

  • Vu, et al., 2021. The Candida glabrata Upc2A transcription factor is a global regulator of antifungal drug resistance pathways. PLoS Genet. 2021 Sep 30;17(9):e1009582.
  • Ni, et al., 2023. The regulatory subunits of CK2 complex mediate DNA damage response and virulence in Candida glabrata. BMC Microbiol. 2023 Oct 28;23(1):317.
  • Kumar, et al., 2024. SWI/SNF complex-mediated chromatin remodeling in Candida glabrata promotes immune evasion. iScience. 2024 Mar 27;27(4):109607.
  • Bhakt et al., 2022. The SET-domain protein CgSet4 negatively regulates antifungal drug resistance via the ergosterol biosynthesis transcriptional regulator CgUpc2a. J Biol Chem. 2022 Oct;298(10):102485.
  • Linde et al., 2015. Defining the transcriptomic landscape of Candida glabrata by RNA-Seq. Nucleic Acids Res. 2015 Feb 18;43(3):1392-406.

C. auris in JBrowse

  • Simm, et al., 2022. Disruption of iron homeostasis and mitochondrial metabolism are promising targets to inhibit Candida auris. Microbiol Spectr 2022 Apr 27;10(2):e0010022.
  • Jakab, et al., 2021. Transcriptional profiling of the Candida auris response to exogenous farnesol exposure mSphere. 2021 Sep-Oct; 6(5): e00710-21.
  • Biermann and Hogan, 2022 Transcriptional response of Candida auris to the Mrr1 inducers methylglyoxal and benomyl. mSphere 2022 Jun 29;7(3):e0012422.
  • Balla, et al., 2023. Total transcriptome analysis of Candida auris planktonic cells exposed to tyrosol. AMB Express 2023 Aug 2;13(1):81.
  • Jenull et al., 2021. Transcriptome signatures predict phenotypic variations of Candida auris. Front Cell Infect Microbiol 2021 Apr 14:11:662563.
  • Chow et al., 2023. The transcription factor Rpn4 activates its own transcription and induces efflux pump expression to confer fluconazole resistance in Candida auris. mBio 2023 Nov 28;14(6):e0268823
  • Shivarathri, et al., 2022. Comparative transcriptomics reveal possible mechanisms of amphotericin B resistance in Candida auris. Antimicrob Agents Chemother. 2022 Jun 21;66(6):e0227621.
  • Pelletier, et al., 2024. Candida auris undergoes adhesin-dependent and -independent cellular aggregation. PLoS Pathog. 2024 Mar 11;20(3):e1012076

Newsletter Archives

CGD Newsletter, Spring 2026

About this newsletter

The goals of the CGD newsletter are to connect with the Candida community, inform researchers about new features in the database, and solicit input from you, our community members. Given that we strive to read most Candida reports, we will also offer "research spotlights" on intriguing new results.

Please feel free to make suggestions for the newsletter and/or the research spotlight by contacting us.


CGD IS GETTING REMODELLED!

This is the biggest announcement in many years. You'll soon see a brand-new appearance for CGD that includes:

  1. A cleaner interface that makes it easier to find what you need
  2. An organism selector added to many pages, allowing you to switch quickly between species
  3. Newly searchable tables that allow you to filter the results and/or sort by column
  4. A brand-new Literature Topic Search tool that allows you to search by topic tag, so you can quickly find all the papers/features related to a given topic or combination of topics.
  5. A brand-new Text Search tool, making it possible to mine CGD data in ways that haven't been possible.
  6. Revisions of outdated pages, including a new "What Is GO?" page that serves as an introduction for trainees
  7. Upgrades to the latest version of JBrowse 2 with the CGD classic style. The visual layout stays nearly identical, but improvements include:
    1. Faster rendering (WebGL improvements)
    2. Better large track handling
    3. Improved plugin system
    4. Improved session handling
    5. Better remote file support
  8. Updated "Genome Snapshots" for each species, now including distributions of GO terms within each category of function, process, and component
  9. New "CGD Paper" pages that list all the phenotypes and GO terms derived from that paper
  10. New "quick links" on the homepage under "CGD Curation News," including one to Disease-related papers. Access the newest literature related to candidiasis in a rapid search.
  11. Improved tools that allow for using larger datasets, including the GO Term Finder.
  12. Introduced CGD Swagger UI, offering a convenient way to retrieve data programmatically. This includes an interactive API Playground for testing endpoints and generating Python and R code snippets.
  13. New Synteny Viewer for the species within CGD, available from the Tools menu or on the Homologs page for each locus

To what do we owe this embarrassment of riches? Our new programmer/developer stepped in just a couple months ago and quickly began building improved tools. That said, we fully expect there will still be bugs and small fixes to make on the new site. Please get in touch whenever you find something that doesn't seem to work correctly. Also, we are open to suggestion for further improvements, so feel free to share your ideas.


Research Spotlight: Fungal extracellular vesicles mediate conserved cross-species communication and immunomodulation

Continuing with the theme of crosstalk within the mammalian host, a recent study examines how fungi employ extracellular vesicles (EVs) for this specific purpose. Piraine et al. describe in a recent mBio paper that fungi use EVs to not only communicate within their own species, but also with other fungal species and with the host.

The study looks at use of EV communication for two Candida spp. (C. albicans and C. auris) and two Cryptococcus spp. (C. neoformans and C. gattii). Study of EVs began in C. neoformans in 2007. Now, after isolating EVs from each species, the researchers labeled them to track "receipt" by other cells. Their study shows that EVs are first recognized and bound at the cell surface, after which they may or may not be internalized. (The yellow arrows in the figure indicate interaction.)

They found that a given species not only recognizes its own EVs but also those produced by near relatives. Further, an inter-phylum association was seen in C. auris recognizing EVs produced by C. neoformans. This is an intriguing result.

A next set of experiments looked at the role of EV-mediated communication on biofilm adhesion and dispersal. For both C. albicans and C. auris, concentrations of EVs from either species above a certain number (10 EVs per cell in a well) consistently increased both biofilm adhesion and dispersal. Further, application of EVs from either species to itself or the other led to increased expression of ERG11 and increased resistance to fluconazole. It thus appears that what EVs deliver contribute to both virulence and resistance, tilting the balance in favor of the pathogen.

With respect to crosstalk between pathobiont fungi and the host, it has been established that fungal EVs carry factors that act as pathogen-associated molecular patterns (PAMPs), which activate the innate immune response (see Brown et al., 2024 for review). These factors are typically fungal cell wall proteins that mammals do not produce, thus are recognized as foreign by immune pattern recognition receptors (PRRs).

Curious about this interaction, the researchers introduced fungal EVs to THP-1 macrophage-like cells and then measured signaling events. They detected an increase in STAT1 signaling linked to M1-type activated macrophages, which then led to downstream immune responses including altered transcription patterns and cytokine production associated with the pro-inflammatory response. Thus, immune cells are recognizing fungi as pathogens via materials contained within EVs and launching a defense.

A particularly interesting finding was the upregulation of the macrophage TLR9 receptor in response to C. albicans and C. auris EVs, which the authors speculate to contain chitin and nucleic acids. In contrast, C. gattii EVs trigger the opposite effect of downregulating TLR9, which could be a form of immune evasion.

The concept that fungal EVs are pivotal to intra- and interspecies communication is a relatively hot new topic, for which CGD recently added a literature topic tag due to the number of papers coming out. However, the nature of the information being communicated by vesicles largely remains unknown. Fungi are likely exchanging "news" of the environment, toward either assisting or hampering certain neighbors within the microbiome. The results of this paper show clear assistance between related fungi.

The communication between fungi and their hosts, however, is harder to interpret. Are immune cells "intercepting" EVs that are meant for other fungi? Or, in the case of the TLR9 repression by C. gattii, have fungi evolved a means to evade detection by sending out vesicles to "disarm" the receptors?

Future studies will have these intriguing questions to tackle.